ID: 994570435

View in Genome Browser
Species Human (GRCh38)
Location 5:101506998-101507020
Sequence GACCCATGGGTTGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994570435_994570438 -7 Left 994570435 5:101506998-101507020 CCAGCAGCAGCAACCCATGGGTC No data
Right 994570438 5:101507014-101507036 ATGGGTCCCCTTCCACGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994570435 Original CRISPR GACCCATGGGTTGCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr