ID: 994570848

View in Genome Browser
Species Human (GRCh38)
Location 5:101511873-101511895
Sequence TGCCTGTGCTGTCAGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994570847_994570848 -7 Left 994570847 5:101511857-101511879 CCTGAGAGCAGGCACATGCCTGT No data
Right 994570848 5:101511873-101511895 TGCCTGTGCTGTCAGTGTGCTGG No data
994570846_994570848 -6 Left 994570846 5:101511856-101511878 CCCTGAGAGCAGGCACATGCCTG No data
Right 994570848 5:101511873-101511895 TGCCTGTGCTGTCAGTGTGCTGG No data
994570845_994570848 2 Left 994570845 5:101511848-101511870 CCTCTTGTCCCTGAGAGCAGGCA No data
Right 994570848 5:101511873-101511895 TGCCTGTGCTGTCAGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994570848 Original CRISPR TGCCTGTGCTGTCAGTGTGC TGG Intergenic
No off target data available for this crispr