ID: 994571503

View in Genome Browser
Species Human (GRCh38)
Location 5:101520594-101520616
Sequence GGGTGCTGCAGCTGAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994571503_994571511 23 Left 994571503 5:101520594-101520616 CCATCTCTTCAGCTGCAGCACCC No data
Right 994571511 5:101520640-101520662 ATACACATTGTCTCAGGAATTGG No data
994571503_994571510 17 Left 994571503 5:101520594-101520616 CCATCTCTTCAGCTGCAGCACCC No data
Right 994571510 5:101520634-101520656 CTGGAAATACACATTGTCTCAGG No data
994571503_994571506 -2 Left 994571503 5:101520594-101520616 CCATCTCTTCAGCTGCAGCACCC No data
Right 994571506 5:101520615-101520637 CCAAATAAAGCCTTCTTCCCTGG 0: 10
1: 57
2: 148
3: 231
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994571503 Original CRISPR GGGTGCTGCAGCTGAAGAGA TGG (reversed) Intergenic
No off target data available for this crispr