ID: 994580928

View in Genome Browser
Species Human (GRCh38)
Location 5:101641027-101641049
Sequence CTGTGTTTATGGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994580928_994580934 26 Left 994580928 5:101641027-101641049 CCCTCTCCCTTCCATAAACACAG No data
Right 994580934 5:101641076-101641098 GCAAATTTAACCATATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994580928 Original CRISPR CTGTGTTTATGGAAGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr