ID: 994581122

View in Genome Browser
Species Human (GRCh38)
Location 5:101643107-101643129
Sequence ACACACTTTCTGTGATTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994581120_994581122 21 Left 994581120 5:101643063-101643085 CCTGATTAGCATTCTACATCATC No data
Right 994581122 5:101643107-101643129 ACACACTTTCTGTGATTTCGTGG No data
994581118_994581122 28 Left 994581118 5:101643056-101643078 CCCTTGTCCTGATTAGCATTCTA No data
Right 994581122 5:101643107-101643129 ACACACTTTCTGTGATTTCGTGG No data
994581119_994581122 27 Left 994581119 5:101643057-101643079 CCTTGTCCTGATTAGCATTCTAC No data
Right 994581122 5:101643107-101643129 ACACACTTTCTGTGATTTCGTGG No data
994581117_994581122 29 Left 994581117 5:101643055-101643077 CCCCTTGTCCTGATTAGCATTCT No data
Right 994581122 5:101643107-101643129 ACACACTTTCTGTGATTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994581122 Original CRISPR ACACACTTTCTGTGATTTCG TGG Intergenic
No off target data available for this crispr