ID: 994581494

View in Genome Browser
Species Human (GRCh38)
Location 5:101648438-101648460
Sequence CAGGCTGCACAATAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994581494_994581511 26 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581511 5:101648487-101648509 AGGTCTGGGGCCTCAGGGTTGGG No data
994581494_994581501 0 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581501 5:101648461-101648483 GTTCCCTACAGGCAATGAGCAGG No data
994581494_994581506 12 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581506 5:101648473-101648495 CAATGAGCAGGTACAGGTCTGGG No data
994581494_994581507 13 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581507 5:101648474-101648496 AATGAGCAGGTACAGGTCTGGGG No data
994581494_994581504 6 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581504 5:101648467-101648489 TACAGGCAATGAGCAGGTACAGG No data
994581494_994581505 11 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data
994581494_994581510 25 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581510 5:101648486-101648508 CAGGTCTGGGGCCTCAGGGTTGG No data
994581494_994581508 20 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581508 5:101648481-101648503 AGGTACAGGTCTGGGGCCTCAGG No data
994581494_994581512 27 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581512 5:101648488-101648510 GGTCTGGGGCCTCAGGGTTGGGG No data
994581494_994581509 21 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581509 5:101648482-101648504 GGTACAGGTCTGGGGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994581494 Original CRISPR CAGGCTGCACAATAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr