ID: 994581505

View in Genome Browser
Species Human (GRCh38)
Location 5:101648472-101648494
Sequence GCAATGAGCAGGTACAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994581492_994581505 17 Left 994581492 5:101648432-101648454 CCACCACCCACCTCCTATTGTGC No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data
994581491_994581505 18 Left 994581491 5:101648431-101648453 CCCACCACCCACCTCCTATTGTG No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data
994581494_994581505 11 Left 994581494 5:101648438-101648460 CCCACCTCCTATTGTGCAGCCTG No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data
994581495_994581505 10 Left 994581495 5:101648439-101648461 CCACCTCCTATTGTGCAGCCTGG No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data
994581500_994581505 -8 Left 994581500 5:101648457-101648479 CCTGGTTCCCTACAGGCAATGAG No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data
994581498_994581505 4 Left 994581498 5:101648445-101648467 CCTATTGTGCAGCCTGGTTCCCT No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data
994581497_994581505 7 Left 994581497 5:101648442-101648464 CCTCCTATTGTGCAGCCTGGTTC No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data
994581493_994581505 14 Left 994581493 5:101648435-101648457 CCACCCACCTCCTATTGTGCAGC No data
Right 994581505 5:101648472-101648494 GCAATGAGCAGGTACAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994581505 Original CRISPR GCAATGAGCAGGTACAGGTC TGG Intergenic
No off target data available for this crispr