ID: 994582913

View in Genome Browser
Species Human (GRCh38)
Location 5:101670411-101670433
Sequence GTGCATTAACTAGGGAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994582913_994582918 9 Left 994582913 5:101670411-101670433 CCCTTATTCCCTAGTTAATGCAC No data
Right 994582918 5:101670443-101670465 ACATGTACAAATTTATGGCAAGG No data
994582913_994582917 4 Left 994582913 5:101670411-101670433 CCCTTATTCCCTAGTTAATGCAC No data
Right 994582917 5:101670438-101670460 ACAACACATGTACAAATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994582913 Original CRISPR GTGCATTAACTAGGGAATAA GGG (reversed) Intergenic
No off target data available for this crispr