ID: 994587823

View in Genome Browser
Species Human (GRCh38)
Location 5:101733454-101733476
Sequence AGGTGTATACACTGTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994587821_994587823 21 Left 994587821 5:101733410-101733432 CCAAGAGTATTACATTTTCTTGT No data
Right 994587823 5:101733454-101733476 AGGTGTATACACTGTGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994587823 Original CRISPR AGGTGTATACACTGTGTTGA AGG Intergenic
No off target data available for this crispr