ID: 994596214

View in Genome Browser
Species Human (GRCh38)
Location 5:101839705-101839727
Sequence CATTATATATAATTGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994596214_994596216 15 Left 994596214 5:101839705-101839727 CCTATCTCCAATTATATATAATG No data
Right 994596216 5:101839743-101839765 GTGTACATGTGTCATAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994596214 Original CRISPR CATTATATATAATTGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr