ID: 994596400

View in Genome Browser
Species Human (GRCh38)
Location 5:101843227-101843249
Sequence AAGGAGGAAAGGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13900
Summary {0: 2, 1: 13, 2: 343, 3: 2093, 4: 11449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994596400 Original CRISPR AAGGAGGAAAGGAGGGAAGT AGG Intergenic
Too many off-targets to display for this crispr