ID: 994601047

View in Genome Browser
Species Human (GRCh38)
Location 5:101905677-101905699
Sequence AACCCCATGCTGTTCTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994601047_994601049 26 Left 994601047 5:101905677-101905699 CCCTTGAAGAACAGCATGGGGTT No data
Right 994601049 5:101905726-101905748 GATTTTTTTAATAAATATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994601047 Original CRISPR AACCCCATGCTGTTCTTCAA GGG (reversed) Intergenic
No off target data available for this crispr