ID: 994601597

View in Genome Browser
Species Human (GRCh38)
Location 5:101912323-101912345
Sequence ATCTAAGAATACAGCTAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994601597_994601599 -4 Left 994601597 5:101912323-101912345 CCTAATTAGCTGTATTCTTAGAT No data
Right 994601599 5:101912342-101912364 AGATATTTTATTCTTTTTGAGGG No data
994601597_994601601 9 Left 994601597 5:101912323-101912345 CCTAATTAGCTGTATTCTTAGAT No data
Right 994601601 5:101912355-101912377 TTTTTGAGGGAATTGTGAATGGG No data
994601597_994601600 8 Left 994601597 5:101912323-101912345 CCTAATTAGCTGTATTCTTAGAT No data
Right 994601600 5:101912354-101912376 CTTTTTGAGGGAATTGTGAATGG No data
994601597_994601598 -5 Left 994601597 5:101912323-101912345 CCTAATTAGCTGTATTCTTAGAT No data
Right 994601598 5:101912341-101912363 TAGATATTTTATTCTTTTTGAGG 0: 83
1: 705
2: 999
3: 954
4: 2263
994601597_994601602 27 Left 994601597 5:101912323-101912345 CCTAATTAGCTGTATTCTTAGAT No data
Right 994601602 5:101912373-101912395 ATGGGATTGCTTTTCCGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994601597 Original CRISPR ATCTAAGAATACAGCTAATT AGG (reversed) Intergenic
No off target data available for this crispr