ID: 994601598

View in Genome Browser
Species Human (GRCh38)
Location 5:101912341-101912363
Sequence TAGATATTTTATTCTTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5004
Summary {0: 83, 1: 705, 2: 999, 3: 954, 4: 2263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994601597_994601598 -5 Left 994601597 5:101912323-101912345 CCTAATTAGCTGTATTCTTAGAT No data
Right 994601598 5:101912341-101912363 TAGATATTTTATTCTTTTTGAGG 0: 83
1: 705
2: 999
3: 954
4: 2263
994601596_994601598 -4 Left 994601596 5:101912322-101912344 CCCTAATTAGCTGTATTCTTAGA No data
Right 994601598 5:101912341-101912363 TAGATATTTTATTCTTTTTGAGG 0: 83
1: 705
2: 999
3: 954
4: 2263
994601595_994601598 -1 Left 994601595 5:101912319-101912341 CCTCCCTAATTAGCTGTATTCTT No data
Right 994601598 5:101912341-101912363 TAGATATTTTATTCTTTTTGAGG 0: 83
1: 705
2: 999
3: 954
4: 2263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994601598 Original CRISPR TAGATATTTTATTCTTTTTG AGG Intergenic
Too many off-targets to display for this crispr