ID: 994601601

View in Genome Browser
Species Human (GRCh38)
Location 5:101912355-101912377
Sequence TTTTTGAGGGAATTGTGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994601596_994601601 10 Left 994601596 5:101912322-101912344 CCCTAATTAGCTGTATTCTTAGA No data
Right 994601601 5:101912355-101912377 TTTTTGAGGGAATTGTGAATGGG No data
994601595_994601601 13 Left 994601595 5:101912319-101912341 CCTCCCTAATTAGCTGTATTCTT No data
Right 994601601 5:101912355-101912377 TTTTTGAGGGAATTGTGAATGGG No data
994601597_994601601 9 Left 994601597 5:101912323-101912345 CCTAATTAGCTGTATTCTTAGAT No data
Right 994601601 5:101912355-101912377 TTTTTGAGGGAATTGTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994601601 Original CRISPR TTTTTGAGGGAATTGTGAAT GGG Intergenic
No off target data available for this crispr