ID: 994601602

View in Genome Browser
Species Human (GRCh38)
Location 5:101912373-101912395
Sequence ATGGGATTGCTTTTCCGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994601597_994601602 27 Left 994601597 5:101912323-101912345 CCTAATTAGCTGTATTCTTAGAT No data
Right 994601602 5:101912373-101912395 ATGGGATTGCTTTTCCGATTTGG No data
994601596_994601602 28 Left 994601596 5:101912322-101912344 CCCTAATTAGCTGTATTCTTAGA No data
Right 994601602 5:101912373-101912395 ATGGGATTGCTTTTCCGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994601602 Original CRISPR ATGGGATTGCTTTTCCGATT TGG Intergenic
No off target data available for this crispr