ID: 994606691

View in Genome Browser
Species Human (GRCh38)
Location 5:101976267-101976289
Sequence CAAGGTAAAGAGAAGGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994606686_994606691 27 Left 994606686 5:101976217-101976239 CCAACAGTTTAAAGACTTCTATA No data
Right 994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994606691 Original CRISPR CAAGGTAAAGAGAAGGATAA TGG Intergenic
No off target data available for this crispr