ID: 994613562

View in Genome Browser
Species Human (GRCh38)
Location 5:102076790-102076812
Sequence GCACTTTTTAAGTTTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994613560_994613562 -10 Left 994613560 5:102076777-102076799 CCTCCAAGGTGAGGCACTTTTTA No data
Right 994613562 5:102076790-102076812 GCACTTTTTAAGTTTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994613562 Original CRISPR GCACTTTTTAAGTTTCATGA AGG Intergenic
No off target data available for this crispr