ID: 994623129

View in Genome Browser
Species Human (GRCh38)
Location 5:102186973-102186995
Sequence TTCTATCTTGATATATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994623129_994623134 26 Left 994623129 5:102186973-102186995 CCTTCCTATATATCAAGATAGAA No data
Right 994623134 5:102187022-102187044 TTAAGTCAAAGATTGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994623129 Original CRISPR TTCTATCTTGATATATAGGA AGG (reversed) Intergenic
No off target data available for this crispr