ID: 994629139

View in Genome Browser
Species Human (GRCh38)
Location 5:102260963-102260985
Sequence TTTACATTGTTATTTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994629139 Original CRISPR TTTACATTGTTATTTGCAGC AGG (reversed) Intronic
900629486 1:3626015-3626037 TTCCCATTGATATTTGGAGCTGG - Intronic
905763107 1:40577167-40577189 TTTATATTGTTACTGGCAGAGGG + Intergenic
906895657 1:49768298-49768320 TTAACATTTTGATGTGCAGCTGG - Intronic
908598027 1:65709169-65709191 TTTACATTGTGCTTTAAAGCTGG - Intergenic
908742932 1:67347310-67347332 TTTTCTTTATTATTTGCATCAGG + Intronic
909739051 1:79006189-79006211 TATACATAGTTATTTGCCACTGG - Intronic
910515698 1:88057471-88057493 TTTACAATGTTAATTGAAGAAGG - Intergenic
910617071 1:89209973-89209995 TTTATATTGCTGTTTGAAGCAGG + Intergenic
911275853 1:95856639-95856661 TTTAAATTGTCATGTGTAGCTGG - Intergenic
911653394 1:100415308-100415330 TTTACAGTTTAATTTGAAGCTGG - Intronic
911948441 1:104139998-104140020 TTTTCATTGTTCTTTCCAGAAGG - Intergenic
914741542 1:150470053-150470075 TATACATTGTTATTTTCAAGCGG - Intronic
916183333 1:162106768-162106790 CGTACATTGTTATTTGCTGGGGG + Intronic
916954694 1:169819946-169819968 TTTCCATTGTTCTTTCCAGAAGG + Intronic
917178908 1:172271175-172271197 TTCACATTGTTGTTTGAAACTGG + Intronic
917618559 1:176771114-176771136 TTTGCATTCATATTTGCAGATGG - Exonic
917732473 1:177889999-177890021 ATTACATTGTTAGTTACAGATGG - Intergenic
920869786 1:209784469-209784491 TTTCCAGTGTTACTTGCGGCTGG - Exonic
921336779 1:214095079-214095101 TATACATTCTTATTTGCACATGG + Intergenic
921560213 1:216648572-216648594 TTTCCATTGTGATTTCTAGCAGG - Intronic
922942625 1:229480988-229481010 TTAACATTGTCATTTGAGGCCGG - Intronic
923940598 1:238820887-238820909 TACACATTATAATTTGCAGCTGG - Intergenic
1063054434 10:2488865-2488887 TTCATATTTTTTTTTGCAGCAGG - Intergenic
1064957914 10:20931787-20931809 TTTACATTCTTATGTGCATCTGG + Intronic
1065668659 10:28089838-28089860 TTTATTTTAATATTTGCAGCTGG - Exonic
1065890662 10:30118565-30118587 TTTCCAGCTTTATTTGCAGCTGG + Intergenic
1068060932 10:52066386-52066408 TTTATATTCTTATTTGAACCCGG + Intronic
1068236090 10:54234253-54234275 TTGACATTGTTATTAGCATTAGG - Intronic
1069086906 10:64151218-64151240 TTTAAATGGTTAATAGCAGCAGG - Intergenic
1071058058 10:81533950-81533972 TTTCCATTGTTATGTGCTGATGG - Intergenic
1071083842 10:81844812-81844834 TTTACATTGAAATTTTCACCTGG + Intergenic
1074096791 10:110320312-110320334 TTATAATTGTTATTTGCAGAAGG - Intergenic
1076387727 10:130069802-130069824 TCTAAATTGTTATTTCCAGATGG - Intergenic
1076465268 10:130676598-130676620 ATTACATTCTAATTTGCAGAAGG - Intergenic
1077808443 11:5612844-5612866 TTTACATTATTTTTTGAAGTAGG - Exonic
1078193756 11:9117002-9117024 TTTAAATTTTTACTTTCAGCTGG - Intronic
1078663514 11:13306078-13306100 TTTTCATTGTTCTTAGCAGGTGG + Intronic
1085285584 11:75358024-75358046 TTTATATTGTTATCTGGAGGAGG - Intergenic
1087266031 11:96062434-96062456 GTTACAAGGTTATTTCCAGCTGG - Intronic
1087521073 11:99237118-99237140 TTTAATTTGTTATTTTCAACAGG + Intronic
1089687607 11:120166720-120166742 TTATCATTGTTATCTGCTGCTGG + Intronic
1090459978 11:126882308-126882330 TTTACCTTGCTGTGTGCAGCAGG + Intronic
1094177519 12:27556613-27556635 TTTCCATTGTGCTTTGCTGCTGG + Intronic
1095368604 12:41439210-41439232 TTAACATTGTTAATTACACCAGG + Intronic
1095617305 12:44206207-44206229 TCTGCCTTGTTATCTGCAGCAGG + Intronic
1095631088 12:44378331-44378353 TTTACATTGTCATTTATAGATGG + Intronic
1096321515 12:50617989-50618011 TGTCCATTGTTATTTGTAGGTGG - Intronic
1098731997 12:74048116-74048138 TTTACCTTGTGCTCTGCAGCAGG + Intergenic
1098965870 12:76787792-76787814 TTTTCATTGTATTTTGGAGCTGG - Intronic
1099772630 12:87081723-87081745 TTTACATTATTTTTTCTAGCAGG - Intergenic
1100138982 12:91592794-91592816 TTTAAATTTTTATTTTCAGTGGG - Intergenic
1100483114 12:94998730-94998752 TTTATTTTATTTTTTGCAGCTGG - Intronic
1101391271 12:104302804-104302826 TATACTTTGCTATTTGCTGCTGG + Intronic
1102312726 12:111859568-111859590 TTAAAATTTTTATTTTCAGCTGG + Intronic
1102565251 12:113793057-113793079 TTTACACTGTTTTTTGCACGTGG - Intergenic
1107208153 13:37820560-37820582 TTTACGTTTTTATGTGCTGCTGG - Intronic
1109668647 13:65573567-65573589 TTTTCAATGTTATTTTCAGCAGG - Intergenic
1109672728 13:65631057-65631079 TTAACAATGTTAATTGCAGATGG - Intergenic
1110581940 13:77140300-77140322 GTTATACTGTTATTTGCAGAGGG - Intronic
1110694310 13:78470046-78470068 TTTACCTTTTTATTTCCACCTGG + Intergenic
1111874217 13:93873187-93873209 TTCACATTGCTATTTGCCACAGG + Intronic
1112347164 13:98599804-98599826 TATACCTTGTAATTTGCAGTGGG + Intergenic
1112902298 13:104372754-104372776 TTTACATTATAATTTGCAAAAGG - Intergenic
1114160407 14:20159479-20159501 GTTACATTCTTACCTGCAGCAGG - Intergenic
1117033605 14:51703432-51703454 TTTACTTTTTAATTTGCATCTGG - Intronic
1119742619 14:77024252-77024274 TTGACAATGCCATTTGCAGCTGG + Intergenic
1120452987 14:84694770-84694792 TTTACTTTGTTTTTAGCTGCAGG - Intergenic
1120685756 14:87534799-87534821 TTAACATTGTGCTTTACAGCTGG - Intergenic
1121853134 14:97241728-97241750 TTAATTTTGATATTTGCAGCAGG - Intergenic
1121957226 14:98225624-98225646 ATTAGGTTGATATTTGCAGCAGG + Intergenic
1123818736 15:24005158-24005180 TCTACATTGATGTTTGCAGTGGG + Intergenic
1126400633 15:48265984-48266006 TTTACATTCTTTTTTGTAGTAGG + Intronic
1126547364 15:49887800-49887822 TTTAGATTGTAATTTGTAGCTGG - Intronic
1126787637 15:52191072-52191094 TTTACATTAATATTGGCATCAGG - Intronic
1127032931 15:54884002-54884024 TTTACATTGCTATTAGGATCAGG + Intergenic
1127247815 15:57197096-57197118 TTTACAGTTTCATTTGCAGAGGG - Intronic
1128868131 15:71131238-71131260 TTTCCATTGTGATTTTCTGCTGG - Intronic
1133539258 16:6732957-6732979 TTTACACATTTATTTGCAGAAGG + Intronic
1135935667 16:26777737-26777759 TTTGCATTGTGATGTGCAGAAGG - Intergenic
1137344987 16:47648526-47648548 CTTACAGGCTTATTTGCAGCTGG + Exonic
1137648609 16:50098247-50098269 TTAAAATTCTTATTTGCAGCTGG + Intronic
1137821206 16:51447743-51447765 TTTACTTTATTTTTTGAAGCAGG - Intergenic
1138060892 16:53889232-53889254 TTTGCATTTTTATATGCATCAGG + Intronic
1138840234 16:60493367-60493389 TTTACATTGTTTGATGCATCTGG - Intergenic
1139556791 16:67717279-67717301 TTTACATTTGACTTTGCAGCAGG - Intronic
1140077381 16:71714109-71714131 TTTATATTTTTAGTAGCAGCAGG + Intronic
1140617197 16:76679772-76679794 TTTATATTGTAATTTGCATCAGG - Intergenic
1141334186 16:83139556-83139578 TTTATTTTGTTATTTGCATCTGG + Intronic
1142906101 17:3042974-3042996 TGTACATTTTTATGTGGAGCTGG - Intergenic
1144379637 17:14681563-14681585 TTTCCATTGTTCTTTGTAGAAGG - Intergenic
1144422403 17:15110231-15110253 TCTGCATTTTTATTTGCATCTGG - Intergenic
1145179985 17:20739901-20739923 TTTACATTGTTAATCACAGCTGG - Intergenic
1146459041 17:33029433-33029455 TCTACATGGTTGTTTGCACCAGG + Intronic
1147533421 17:41301477-41301499 GTCACATTTTTATTAGCAGCTGG + Intergenic
1147548241 17:41419732-41419754 TTTTCATTGCTCTTTGCACCAGG + Intergenic
1148525845 17:48333338-48333360 TTTACATTTTTATTTAATGCTGG - Intronic
1148814807 17:50319924-50319946 TTTACTTAGTTCTCTGCAGCAGG - Intergenic
1148881880 17:50734646-50734668 TTAAGATTATTCTTTGCAGCTGG - Intronic
1149344202 17:55717747-55717769 TTAACCTTGTTCTGTGCAGCTGG - Intergenic
1149621804 17:58050913-58050935 GGTAGCTTGTTATTTGCAGCTGG + Intergenic
1149839702 17:59949591-59949613 TTTACATTGTTAATCACAGCTGG - Exonic
1153900176 18:9611713-9611735 TTTAAAAAGTTAGTTGCAGCCGG + Intronic
1154041068 18:10856660-10856682 TGCACATTGTTAATTGCAGCAGG + Intronic
1155307528 18:24493109-24493131 GTTACCTTGTTATTTTAAGCTGG + Intergenic
1155656804 18:28202203-28202225 TGAACATTGTTATTTGCTGTCGG - Intergenic
1155938369 18:31777675-31777697 TGTAGATTGCTATTTGGAGCAGG + Intergenic
1156672504 18:39487669-39487691 AATACATTTTTATTTGTAGCAGG - Intergenic
1157672752 18:49544059-49544081 TTCTCATTCTTTTTTGCAGCTGG + Intergenic
1158657269 18:59349607-59349629 TTTACAATTTTATCTGCAGCTGG + Intronic
1158745053 18:60190290-60190312 TTTGTTTTGTTTTTTGCAGCTGG + Intergenic
1160217376 18:76944345-76944367 TTTGTATTATTATTTGCAGTTGG - Intronic
1161842438 19:6690904-6690926 TGTACATTGACATTTGCAGAAGG - Intronic
1163082181 19:14952141-14952163 TTTAAATATATATTTGCAGCTGG + Intronic
1167960321 19:53099669-53099691 TTTAAATTTTTAATTGCAGTGGG + Intronic
926972712 2:18483026-18483048 TTTACATAGTTATTTTCAGGGGG - Intergenic
928486745 2:31739852-31739874 TTTACCTTGTTATTTCCCTCGGG - Intergenic
929037428 2:37707790-37707812 TTTAAATTATTTTTTGCAGAGGG + Intronic
929178418 2:39005665-39005687 ATAACATTGTTATATGCAGTGGG + Intronic
931020651 2:58041234-58041256 TTTACATTTTGTTTGGCAGCAGG + Intronic
931393827 2:61868131-61868153 TATACACTTTTATTTGCAGAAGG + Exonic
932470447 2:71951617-71951639 TTTAAATTGTCACATGCAGCTGG - Intergenic
932907107 2:75765954-75765976 TTGACTTTGCTCTTTGCAGCAGG + Intergenic
932942210 2:76180891-76180913 TTTTCATTGTTACTTGCTGTGGG + Intergenic
933054185 2:77641873-77641895 TTTTCATTGGTATCTGCTGCTGG + Intergenic
933439275 2:82290586-82290608 ATGACTTTCTTATTTGCAGCTGG + Intergenic
935552877 2:104477301-104477323 TTGACATTGTCATTGGCAGAAGG - Intergenic
935762000 2:106329830-106329852 TTTACCTTTTTATTTGGATCAGG + Intergenic
937206771 2:120241552-120241574 TTTATATTTTTAGTAGCAGCGGG - Intronic
937514631 2:122639317-122639339 TTTGCATTCTCATTTGAAGCAGG + Intergenic
938661928 2:133495784-133495806 TTTAAAATGTAATTTTCAGCTGG - Intronic
941646089 2:168042949-168042971 TTTACATAGTATTTTGCAGGTGG - Intronic
943062543 2:183053510-183053532 TTTAGCTAGTTATCTGCAGCAGG + Intergenic
943459369 2:188152109-188152131 TTCACATTGGCATTTGGAGCTGG - Intergenic
943901757 2:193447700-193447722 TTTGGCTTGTTATCTGCAGCAGG + Intergenic
943949645 2:194116080-194116102 TTTACATTGTTGTGTGTATCTGG - Intergenic
944028070 2:195196215-195196237 ATAACATTGTCATTTGCAGTAGG + Intergenic
944108425 2:196104457-196104479 TTTATATTTTTATTTGCATAGGG + Intergenic
944728505 2:202496606-202496628 TTTCCATTTTTATTTGCATGTGG - Intronic
944959104 2:204849795-204849817 TTAGCATTTTTTTTTGCAGCTGG + Intronic
945456352 2:210056305-210056327 TTTACAGTGCAATTTGCAGCGGG - Intronic
946027411 2:216680115-216680137 TTTAGATTGTTGTTTCCAGGCGG + Intronic
948937414 2:241176277-241176299 TTTCCAATGTTATCTGTAGCTGG - Intronic
1170900913 20:20462344-20462366 TTTACATTGTGTTTTGCACATGG - Intronic
1171323667 20:24270410-24270432 TGTACACTGTTATTTGAAGGTGG - Intergenic
1172055079 20:32149035-32149057 TGTACTTTGTTATTTTCAGTTGG - Intronic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172457010 20:35084883-35084905 TTAGCATTATTATTTACAGCAGG - Intronic
1172967823 20:38851100-38851122 ACTACATTGTTATTTGCAGTTGG + Intronic
1174806852 20:53611540-53611562 TTAAAATGGTTAGTTGCAGCTGG - Intergenic
1178961051 21:37065291-37065313 TTTATATTGTAATTTGCAAAGGG - Exonic
1183684502 22:39353789-39353811 TTTATATTCTTTTTTGCAGGGGG + Intronic
1184696450 22:46141971-46141993 TTTGTATTATTATTTGCAGAAGG - Intergenic
1185237323 22:49721720-49721742 TTTAAGTTTTTATTTTCAGCTGG + Intergenic
949278721 3:2320690-2320712 TTCACATTGATATTTGCTTCGGG - Intronic
949570815 3:5291257-5291279 TTTACAATGTGATCTGGAGCAGG - Intergenic
950384257 3:12644661-12644683 TTTACATTGTTTATTGCATGTGG - Intronic
953572742 3:44084474-44084496 TTTACATTATGACTTGCAGAGGG + Intergenic
953918174 3:46934079-46934101 TTTAAATTGATATTTACAACCGG - Intronic
954922715 3:54205387-54205409 TTTAAATTTTCACTTGCAGCTGG - Intronic
955066190 3:55535549-55535571 TTTCCACTGTTATCTGCTGCCGG - Intronic
955569950 3:60293966-60293988 TTTAAAATGTAATTTGCAGTAGG - Intronic
955659459 3:61281184-61281206 TTTACATGGTTTTTGGCAGAAGG - Intergenic
955751433 3:62188741-62188763 TGTTCATTGCTATTTGGAGCAGG + Intronic
956080077 3:65548817-65548839 TTAAGAGTGTTGTTTGCAGCCGG - Intronic
956095635 3:65713138-65713160 TGTTCATTGGCATTTGCAGCAGG + Intronic
957675733 3:83361666-83361688 TCTGCCTTGTTATCTGCAGCAGG - Intergenic
957703792 3:83753662-83753684 TGTACACTGTTATTTTTAGCAGG - Intergenic
959410439 3:106014814-106014836 ATTACATTATTATTTTTAGCTGG - Intergenic
961424759 3:126836299-126836321 TTTGCATTGGTTTTTTCAGCAGG + Intronic
961606798 3:128101645-128101667 TTTACATTTTTTTTTTTAGCTGG - Exonic
962265098 3:133939157-133939179 TTTACATTTTCATTTGCAATAGG + Intronic
963989069 3:151632348-151632370 TTTAGGTTTTTATTTGCAGAAGG + Intergenic
964360738 3:155893499-155893521 TTTGTATTGATATTTGCAGCTGG + Exonic
964453252 3:156832897-156832919 TTTGCTTTGTTTTTTGCAACAGG - Intronic
964517159 3:157524272-157524294 TTTACATTCTCATCTGCAGTGGG + Intronic
964913662 3:161813009-161813031 TTTCAATTGTTTTTGGCAGCTGG - Intergenic
965120346 3:164546677-164546699 TTATAATTGTTATTTGCAGGAGG + Intergenic
966177805 3:177158187-177158209 TTTACAGTGGAATTTGCAGCAGG - Intronic
966470521 3:180283771-180283793 TTTACTCTGCTAGTTGCAGCAGG - Intergenic
966715972 3:183013101-183013123 ATTACATTTTTCTATGCAGCTGG + Intergenic
969846148 4:9921632-9921654 TTTGGAGTGTTATTTCCAGCAGG + Intronic
969961621 4:10950194-10950216 TTTACACTTATATTTGCAGATGG + Intergenic
971373346 4:26035976-26035998 TTTACATTGTTATTACAAGAGGG + Intergenic
971621726 4:28863063-28863085 TTTTCATTGACATTTGCAGTAGG + Intergenic
973009036 4:45048747-45048769 TTTGGCTTGTTATCTGCAGCAGG - Intergenic
974637988 4:64590312-64590334 ATAACATTTTTTTTTGCAGCCGG + Intergenic
975088466 4:70372068-70372090 TTTACATTGTTATTTCATCCTGG - Intronic
975156808 4:71081391-71081413 TTTTCATTGGGATCTGCAGCTGG - Intergenic
975462565 4:74671470-74671492 TTCACATTATTATTTGCTTCTGG + Intergenic
975881524 4:78913830-78913852 ATTACATTATTATTTAGAGCTGG + Exonic
976261889 4:83153469-83153491 TTTAAATTGTTTTAAGCAGCAGG + Intergenic
976640486 4:87332684-87332706 TATACATTCTTATTTGCACATGG - Intergenic
979143191 4:117204575-117204597 TTAACTTTTTTATTTGCTGCTGG - Intergenic
980562188 4:134491829-134491851 TTTCCATTGTTATTTGTTTCAGG - Intergenic
982756221 4:159221546-159221568 TTTATATTATTATTTTTAGCAGG - Intronic
982868108 4:160543516-160543538 TTTACAGTCTTATATGCAGAAGG - Intergenic
983315490 4:166127409-166127431 TTTACAGTGTTATTTTCATTAGG - Intergenic
983951241 4:173644445-173644467 TTTACATTTTTATATGTAGCTGG + Intergenic
985051175 4:185993524-185993546 TTGACATTGGTATGTACAGCAGG + Intergenic
986564001 5:9092306-9092328 TTTACAATTTTATTTACAGGAGG + Intronic
987123124 5:14786414-14786436 TTTGCATTTTTATTTGGACCTGG + Intronic
987604307 5:20112860-20112882 TTTACACTGAAATTTGGAGCAGG + Intronic
988299862 5:29408561-29408583 TTTACATTCTTATTTGTTTCAGG - Intergenic
989326933 5:40208248-40208270 AATACATTGTTATTTGCTGTTGG + Intergenic
989498900 5:42142564-42142586 TTTACAATGTCCTTTGCAGCAGG - Intergenic
990462736 5:56044969-56044991 TTTACATTGTTATTTTTATGTGG - Intergenic
992930792 5:81642931-81642953 TTTTCATTCTTATTTGCTTCTGG + Intronic
994242167 5:97436534-97436556 ATTACATATTTATTTGCAGGTGG + Intergenic
994501723 5:100587827-100587849 TTTAAAATGTTATTAGCGGCCGG + Intergenic
994520439 5:100827648-100827670 TTTACATTCTGAATGGCAGCTGG + Intronic
994629139 5:102260963-102260985 TTTACATTGTTATTTGCAGCAGG - Intronic
994654291 5:102570529-102570551 TTTACATTTTTATTTGTTTCAGG - Intergenic
994697769 5:103093866-103093888 TTTTCATTGCTATTTTAAGCAGG - Intronic
994752703 5:103758267-103758289 TTTACATTTATATTTTCACCTGG - Intergenic
994793403 5:104261704-104261726 TTTAGATTATTATTTTCAGGGGG - Intergenic
994943738 5:106358958-106358980 CTTACATTGTTAAAAGCAGCAGG + Intergenic
995854760 5:116579333-116579355 TCTACATTTTTTTTTCCAGCAGG - Intergenic
996629504 5:125610567-125610589 TTGACATTGTTATCTGCATGTGG - Intergenic
996811951 5:127525603-127525625 TTTACCTTCTTATTAGCAGTGGG + Intronic
999443150 5:151618509-151618531 TTTTCATGATTCTTTGCAGCTGG - Intergenic
999841117 5:155428159-155428181 TTTAAATTGTTATTTTCAAAAGG + Intergenic
1000772627 5:165375454-165375476 TTTACAGTCTTCTTTACAGCTGG - Intergenic
1003483676 6:6556072-6556094 CTTACAGTGTTAGTTGCAGGGGG - Intergenic
1003829569 6:9993199-9993221 CATACCTTCTTATTTGCAGCTGG - Intronic
1003889859 6:10554478-10554500 TTTACATTATTGTTTCCAACTGG - Intronic
1005215471 6:23522353-23522375 ATTCCATTGTTAATTGCAGGTGG + Intergenic
1005613914 6:27554716-27554738 TTTAAATCTTTATTTTCAGCTGG + Intergenic
1006277119 6:33013898-33013920 TTGCCATCGTTTTTTGCAGCAGG + Intergenic
1006995507 6:38256293-38256315 ATTACATTCTTATTTGGAGGTGG - Intronic
1007560151 6:42800813-42800835 TTAACATTGTTATTTTCATAGGG + Intronic
1008200741 6:48586404-48586426 TTTATTTTGTTATATGCAGTTGG + Intergenic
1008232429 6:48999250-48999272 TTTTCATTGTGGTTTACAGCTGG + Intergenic
1009861395 6:69338521-69338543 TGTTCATTGTTAATTGCAGAAGG - Intronic
1010659679 6:78555766-78555788 TTTACAGGGTTATATGCAGAAGG - Intergenic
1010733852 6:79419801-79419823 TTTACATTCTTACCTGCAGTAGG - Intergenic
1011255698 6:85418636-85418658 TTAATATTGTTATTAGCAGGAGG + Intergenic
1012530458 6:100229234-100229256 TCTCCAGTGTTATTTGCAGATGG - Intergenic
1012579921 6:100854705-100854727 GTTACATTGTAATTTGATGCAGG - Intronic
1014208227 6:118680119-118680141 TTTAAATTTTTTTTTGGAGCTGG - Intronic
1014538289 6:122643451-122643473 ATTACATTTTTATTTCCAGCAGG - Intronic
1015737836 6:136420158-136420180 TCTTCATTGTTATCTGCAGTGGG + Intronic
1017517516 6:155170303-155170325 TTTACATTGTTATATAATGCTGG - Intronic
1017746779 6:157454113-157454135 TTTTCATTGTTAGCTGTAGCTGG + Intronic
1018654165 6:166017742-166017764 TTTATTTTGTTATTTGTACCTGG - Intergenic
1019465082 7:1183582-1183604 TTTCCATTGTGATTTGCTCCTGG + Intergenic
1023329751 7:39102137-39102159 ATTAAATGGTTATTTGCACCTGG - Intronic
1023418484 7:39952571-39952593 TTTATAATGTTATTAGCAACTGG - Intronic
1023902094 7:44489775-44489797 TTTACACTCTTAGTTGCCGCAGG - Intronic
1024322145 7:48081896-48081918 ATTACATTTTTATTTCCAGCAGG + Intergenic
1025750227 7:64287480-64287502 TTGAAATTGTGATGTGCAGCTGG - Intergenic
1025803204 7:64807092-64807114 TTTGGCTTGTTATCTGCAGCAGG - Intronic
1027861681 7:83591293-83591315 TTTAATTTGTTACTGGCAGCAGG - Intronic
1027943916 7:84722117-84722139 TTTTCATCTTTATTTACAGCTGG + Intergenic
1029911942 7:104162017-104162039 TTTACATTGTTTTAGGCTGCTGG - Intronic
1030321523 7:108173357-108173379 TTTACATTTTTATTTAAATCAGG - Intronic
1030888941 7:114973385-114973407 TATACTTTGTTTTTTGCAGTTGG - Intronic
1032830785 7:135623275-135623297 TTTATTTTATTTTTTGCAGCAGG - Intronic
1036539459 8:9690586-9690608 TTTACATTTTTAGTAGAAGCAGG - Intronic
1037048956 8:14344768-14344790 TTTATATTTTCATTTGTAGCTGG - Intronic
1037851299 8:22331472-22331494 TTTTTATTTTTATTTGCAACAGG - Intronic
1037982659 8:23265545-23265567 TTTTCATTGTATTTTGCAGCAGG + Intergenic
1039645308 8:39276198-39276220 TTTACTTTTTTATTTGGAGATGG + Intronic
1039755035 8:40513570-40513592 TTTAAATAGTAATTTGCAGAGGG + Intergenic
1040717517 8:50275515-50275537 GTTATAATGTTATTTGAAGCCGG - Intronic
1041703479 8:60818263-60818285 TAGACATTTTTAGTTGCAGCAGG - Intronic
1042776254 8:72435181-72435203 TTTACATTTCTATTTGTAGAAGG - Intergenic
1043074228 8:75675637-75675659 TTTTTATTGATATTCGCAGCTGG - Intergenic
1044150337 8:88769080-88769102 TTTACATAGTTATTTGAAAAGGG - Intergenic
1045791907 8:105993429-105993451 TTTACTTTGTTATTTACTTCTGG + Intergenic
1046620897 8:116528565-116528587 TTAACATTGTTATCAGCAGTTGG - Intergenic
1048558909 8:135511317-135511339 ATTACAATGATATTAGCAGCTGG - Intronic
1048798847 8:138177420-138177442 TTTACATTGTTTTATTCTGCAGG - Exonic
1049733072 8:144189086-144189108 TTTAGATTGTGCTTTGGAGCAGG + Intronic
1050168175 9:2788358-2788380 TCTACATTAATATTAGCAGCAGG - Intronic
1050328398 9:4520170-4520192 TTCAAATTGTTATTTCCAGACGG + Intronic
1051988757 9:23124570-23124592 TCTACAATATTATTTTCAGCTGG - Intergenic
1053004498 9:34595176-34595198 TTCACATTGTTGTATGTAGCTGG - Intergenic
1053171152 9:35885435-35885457 TTAATATTGATATTTGCAGCTGG - Intergenic
1053219147 9:36297248-36297270 TTTACATTGTTAATTCCTGCAGG - Intronic
1054737371 9:68768901-68768923 TTTACTTTATTATTAGCACCAGG - Intronic
1056405760 9:86273269-86273291 TGTACATTGTTAGTTGCCGATGG - Intronic
1058024764 9:100129486-100129508 TTTACATTTTTTTTTGAGGCAGG - Intronic
1059084929 9:111290511-111290533 TTTAAAATTTTATTTGCAACAGG - Intergenic
1187726245 X:22205267-22205289 TTTACTTTGTCATTTGCCCCTGG + Intronic
1188001475 X:24986573-24986595 TTTACATTTTTATGTGGAGATGG - Intronic
1188054059 X:25521425-25521447 TTTACATGTTTATTTTCAGAAGG + Intergenic
1188542319 X:31264675-31264697 TTTATATTTTAATTTGCATCAGG - Intronic
1189657687 X:43263677-43263699 TTTCCATTGTTATTTGTTTCAGG + Intergenic
1191015356 X:55804159-55804181 TTTACATTCTCAGTTGGAGCGGG + Intergenic
1191138432 X:57091153-57091175 TATACATTCTTATTTGCACATGG + Intergenic
1192062922 X:67848805-67848827 TTTAAATTGTTATTTGTCTCAGG - Intergenic
1194189851 X:90821581-90821603 TTTAATTTTTTATTTCCAGCTGG - Intergenic
1194394485 X:93364806-93364828 TTTCCATCGTTTTTTGCAGAAGG + Intergenic
1194428945 X:93776623-93776645 TTTAAATTTTTATTCTCAGCCGG - Intergenic
1195902670 X:109815204-109815226 TTGACATTGATATTGGCAACTGG - Intergenic
1196548194 X:116990224-116990246 ATTACATTGTCATCTGCAGGAGG - Intergenic
1199341305 X:146680355-146680377 TTTATCTAGTTATCTGCAGCTGG + Intergenic
1200536455 Y:4403693-4403715 TTTAATTTTTTATTTCCAGCTGG - Intergenic
1201538093 Y:15073468-15073490 TTTAAATTTTTATTTACATCTGG - Intergenic
1201891011 Y:18943765-18943787 TTTAAATTGGTATTTGTGGCTGG - Intergenic