ID: 994630629

View in Genome Browser
Species Human (GRCh38)
Location 5:102281885-102281907
Sequence ATGCCCAGGAGTAAAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2100
Summary {0: 1, 1: 5, 2: 41, 3: 333, 4: 1720}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994630629 Original CRISPR ATGCCCAGGAGTAAAACTGC TGG (reversed) Intronic
Too many off-targets to display for this crispr