ID: 994631212

View in Genome Browser
Species Human (GRCh38)
Location 5:102290387-102290409
Sequence ACTCACTGACCCCATTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994631207_994631212 30 Left 994631207 5:102290334-102290356 CCACGCCTAGCTCAAACTCTCTT 0: 1
1: 0
2: 1
3: 24
4: 289
Right 994631212 5:102290387-102290409 ACTCACTGACCCCATTCCCAGGG 0: 1
1: 0
2: 2
3: 22
4: 189
994631208_994631212 25 Left 994631208 5:102290339-102290361 CCTAGCTCAAACTCTCTTTAACA 0: 1
1: 0
2: 6
3: 20
4: 261
Right 994631212 5:102290387-102290409 ACTCACTGACCCCATTCCCAGGG 0: 1
1: 0
2: 2
3: 22
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994631212 Original CRISPR ACTCACTGACCCCATTCCCA GGG Intronic
900246078 1:1636763-1636785 ACCCACTGACCACATGTCCACGG + Exonic
901671344 1:10858013-10858035 CCTCACTGGCCCCAGTGCCAAGG - Intergenic
904002658 1:27347708-27347730 ACCCACCCACCCCATGCCCACGG - Intronic
904364222 1:30000160-30000182 ACTCAAAGACCCCATTCCAAAGG + Intergenic
904402710 1:30267241-30267263 ACTCCCTGCCCCGCTTCCCAAGG - Intergenic
904946839 1:34205661-34205683 GCTCTCTGACCCCATTTCCTTGG - Intronic
905105117 1:35559299-35559321 ACTCACTGACCCCATTCCTTGGG - Intronic
905700999 1:40014071-40014093 TTTCACTGACCCCATTTTCACGG - Intergenic
907444894 1:54501258-54501280 TCCCACTGACCCCATCCCCCAGG + Intergenic
910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG + Intergenic
912159102 1:106959423-106959445 ACTCTGTGACCCCACTCCCCTGG + Intergenic
912593469 1:110850779-110850801 ACTTACTGAGCACATTCCCTGGG + Intergenic
912749812 1:112277405-112277427 CCTCACTCAACCCATTTCCATGG + Intergenic
913328241 1:117646394-117646416 ACTCAGTGAGCCAAGTCCCAGGG - Intergenic
917444125 1:175092318-175092340 ACTGTCTGACCCCATGGCCAGGG - Intronic
918243448 1:182639784-182639806 AGTCACTAATCCCATTCACAAGG - Intergenic
920001951 1:202807067-202807089 ACTCACTGCCCCCAGGCCCGAGG + Intronic
920101547 1:203520097-203520119 ACTGACTGGCATCATTCCCATGG - Intergenic
921316425 1:213895756-213895778 ACACACTCACCCCATGCCAAGGG + Intergenic
921320730 1:213935828-213935850 ACTAACAGACCCCATCCACAAGG - Intergenic
921718832 1:218448431-218448453 ATTGTCAGACCCCATTCCCAGGG + Intergenic
922298876 1:224278034-224278056 CCAGACTGAACCCATTCCCATGG + Intronic
923133496 1:231097483-231097505 AATCACTGAGCCCATGCCCAGGG - Intergenic
924802393 1:247336925-247336947 TCTCACTGACCCCTTTCCACAGG - Intergenic
924870066 1:248032513-248032535 ACTCCCTTCCCCCATCCCCAGGG + Intronic
1063696540 10:8340972-8340994 ACTCACTCAACCAAATCCCATGG + Intergenic
1064014019 10:11759031-11759053 AGTCACTGATCTCATTCACAAGG - Intronic
1064258161 10:13762947-13762969 TCTCACTCACCCCATTACCCAGG - Intronic
1067047928 10:42996356-42996378 AGTCGCTGTCTCCATTCCCAGGG - Intergenic
1071563888 10:86661863-86661885 AGTCACTCACCACCTTCCCAAGG + Intronic
1073320546 10:102613705-102613727 ACCCACTGATCCCATTCAAAAGG - Intronic
1073512150 10:104049377-104049399 ACTCACTGAATCCATTCCTTTGG + Intronic
1078011251 11:7574712-7574734 GCTCACTCACCCCACCCCCAGGG - Intronic
1079420163 11:20278580-20278602 ACACACAGACCCCATCCGCACGG - Intergenic
1081020843 11:37946812-37946834 CCACACTGAAGCCATTCCCATGG - Intergenic
1082875431 11:57983446-57983468 ACTCACTGAGCTCATTCTCCTGG + Intergenic
1082983182 11:59142957-59142979 TCTCACTGACCCCGTGCCCACGG - Intronic
1084448823 11:69220617-69220639 ACTCAATGGCTCCATTCCCAGGG - Intergenic
1085192449 11:74639756-74639778 ACTCACTGAACCCTTCCCAAGGG - Intronic
1086285660 11:85247319-85247341 GTCCACTGACCCCATGCCCAGGG - Intronic
1089467863 11:118697180-118697202 ACTGACTGTCTCCATTCCCCTGG - Intergenic
1090351456 11:126111043-126111065 GTGCACTAACCCCATTCCCAGGG + Intergenic
1092802408 12:12183153-12183175 ACTCCCTGGCCCCCTTGCCAGGG + Intronic
1102337711 12:112096056-112096078 ACTCCCTCTCCCCATCCCCATGG - Intronic
1102347922 12:112171382-112171404 ACTCACTGACAGCATCTCCAGGG - Intronic
1103873319 12:124106876-124106898 ACTGGCTCAGCCCATTCCCAGGG - Intronic
1104659642 12:130601307-130601329 CCTCTTTGACCCCATCCCCAGGG - Intronic
1106587953 13:31073366-31073388 GGTGACTCACCCCATTCCCATGG + Intergenic
1108373920 13:49795920-49795942 ACTCACTCTCCACCTTCCCAAGG + Intergenic
1113131800 13:107045264-107045286 GCTCACTCATCCCATTCACAAGG - Intergenic
1113327113 13:109293101-109293123 AGTATCTCACCCCATTCCCAGGG - Intergenic
1113838252 13:113343639-113343661 AGTCACCCACCCCATTTCCAGGG - Intronic
1114577115 14:23725557-23725579 ACTCACTGGCACCTGTCCCATGG + Intergenic
1115341615 14:32298766-32298788 ACACCCTGATCCCATGCCCAGGG + Intergenic
1119188521 14:72662600-72662622 ACAAACTGAGGCCATTCCCAAGG + Exonic
1120548741 14:85843707-85843729 ATTTAATGATCCCATTCCCAAGG + Intergenic
1120592814 14:86395461-86395483 ACTCACTCACCCCCTCCCCAGGG + Intergenic
1121438673 14:93935164-93935186 ACCCTCTGACCCCATTGCTAAGG - Intronic
1121616037 14:95314485-95314507 ACTCCTTGACCACCTTCCCAGGG + Intronic
1122042209 14:98996835-98996857 AGACACTCACCCCCTTCCCACGG - Intergenic
1122918487 14:104869670-104869692 GGTCCCTGATCCCATTCCCAAGG - Intronic
1123969636 15:25494958-25494980 ACTCTCTGACCCAATTCTCAGGG + Intergenic
1125713258 15:41804251-41804273 AGACACTGACCCCAAACCCAGGG - Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1129880812 15:79005042-79005064 AGTCACTGAGATCATTCCCAGGG - Intronic
1130431138 15:83848031-83848053 ACACACACACACCATTCCCAAGG - Intronic
1130899368 15:88195554-88195576 CCCCTCTGACCCCAATCCCATGG - Intronic
1131620946 15:94067552-94067574 ACCCTCTGACCACATTCCTATGG - Intergenic
1137501895 16:49018247-49018269 CCTCACTGACCTCATCCCCAAGG + Intergenic
1137899171 16:52246262-52246284 ACACACACACCCCATTCCCATGG - Intergenic
1139436478 16:66939521-66939543 ACTCTGTGACCCCATGTCCAGGG - Intronic
1140218805 16:73028725-73028747 GCCCACTGCCCCCTTTCCCAGGG - Intronic
1141435787 16:83999047-83999069 ACTCATTCACCCCATTGCCTGGG + Intronic
1142588128 17:987317-987339 ACCCGGTGACCCCATTCCCTGGG - Intergenic
1142588178 17:987478-987500 ACCCAGTGACCCCATTCCCCGGG - Intergenic
1142588187 17:987515-987537 AGTCGGTGACCCCATTCCCTGGG - Intergenic
1142588198 17:987544-987566 ACCCGGTGACCCCATTCCCTGGG - Intergenic
1144326793 17:14190237-14190259 ACTAACTGGCCCCATTTCAAGGG - Intronic
1144475675 17:15587101-15587123 ACTAACTGGCCCCATTTCAAGGG - Intronic
1144944763 17:18964195-18964217 GCTCACTGGCCGCATCCCCAGGG + Intronic
1149319337 17:55468579-55468601 ACCCACTCACCACATTCCCTTGG + Intergenic
1151583883 17:74996691-74996713 CCTCCCTGACCCCAGTCCAAGGG - Intronic
1152391653 17:80007292-80007314 GCTCGCTGACCCCATACCCCAGG + Intronic
1152525079 17:80883951-80883973 CCTCTCCGACCCCATTCCCGAGG + Exonic
1152786891 17:82252987-82253009 GGTCAGTGACCCCATGCCCAGGG + Intronic
1159314754 18:66757610-66757632 AGTCACTATCCCCATACCCATGG + Intergenic
1159879769 18:73847153-73847175 ACTCAGTGACCCCATGGCCCAGG + Intergenic
1160362641 18:78297018-78297040 GGCCACTGACCCCATTCCCCCGG - Intergenic
1161231583 19:3177394-3177416 ACTTGCTCACCCCATCCCCATGG - Intronic
1161778305 19:6275844-6275866 ACTCTCTGACCACATTGTCAGGG + Intronic
1163478534 19:17540591-17540613 GCTCACTGAACCCCTACCCACGG - Intronic
1165393294 19:35550427-35550449 ACTCCCCTCCCCCATTCCCAAGG - Exonic
1167349109 19:48963866-48963888 ACTCGCTGACCTCATCCCCTTGG - Intergenic
925294816 2:2769437-2769459 ACTCACTGCCCCCACCACCATGG + Intergenic
926355067 2:12034111-12034133 ACCCACTGCCCCCATTCCATGGG - Intergenic
926886847 2:17605788-17605810 ACTCCCTGCCTGCATTCCCAGGG - Intronic
927980116 2:27369866-27369888 CCTCACTTACCCCAGGCCCAGGG + Exonic
928238651 2:29567653-29567675 ACTCCCCGAAACCATTCCCAAGG + Intronic
928970264 2:37020795-37020817 TCTCTCTGACCTCATTCGCATGG - Exonic
929459033 2:42087928-42087950 ACTCACTGCCCACATTACAAAGG - Intergenic
930019722 2:46994210-46994232 ACTCCCCAACCCCACTCCCAAGG - Intronic
932428721 2:71660333-71660355 ACTCAGGTGCCCCATTCCCACGG + Intronic
933052020 2:77612091-77612113 ACTCAGTGGGCCCCTTCCCATGG + Intergenic
936514224 2:113171752-113171774 ACTGAGTGACCCCAGTTCCAAGG - Intronic
941486861 2:166092960-166092982 ACTCTTTCACCCCTTTCCCATGG + Intronic
946250188 2:218406716-218406738 CCTCACTCACCCCTTTCCCGGGG + Intergenic
946591606 2:221255444-221255466 ACCCACTGTCAGCATTCCCATGG + Intergenic
947820228 2:233064008-233064030 ATTGACTGACCCCATTCCCAAGG - Intronic
947872316 2:233446230-233446252 ACTCACTGACCACATGCCTGTGG + Intronic
948100715 2:235370581-235370603 ACTTACTGTTCCCATTCCCAGGG - Intergenic
948378131 2:237535701-237535723 GAGCACTGACCCCATTCCTATGG - Intronic
1170046371 20:12089766-12089788 CCCCACTGACCCCATTTCCCAGG + Intergenic
1171299582 20:24048580-24048602 CCTCTCTTACCCCATTCTCAAGG + Intergenic
1172847872 20:37940582-37940604 ACTCACTGACTCCATGCCTCTGG + Intronic
1176976338 21:15326519-15326541 AGTCACTGTGCCCATTCCAAGGG + Intergenic
1179352196 21:40622451-40622473 CCCCACCGACACCATTCCCATGG + Intronic
1180892392 22:19299107-19299129 GATCACTGACCCCATTCCTTTGG + Intergenic
1181049185 22:20230715-20230737 ACTCACAGACCCCAGGCACAGGG + Intergenic
1181745604 22:24953221-24953243 TCTCTCTGAATCCATTCCCAAGG - Intronic
1181851845 22:25755051-25755073 ACTCACAGACTCCATGCCTAAGG - Intronic
1182000093 22:26913197-26913219 ACTCAATGATCCCCTTCCCTAGG + Intergenic
1183006080 22:34903583-34903605 ACTCCCTGACCCCATTACTGAGG - Intergenic
1184234495 22:43175618-43175640 ACTCACTGCCAGCATTTCCATGG + Intronic
1184648171 22:45907320-45907342 CCTCACTGGCCCAATTCACAGGG + Intergenic
1185165606 22:49260526-49260548 ACTCACTCACTCCATACTCATGG + Intergenic
1185398684 22:50605112-50605134 ACTCCCTGGCCCCAGTCCCAGGG + Intronic
950690174 3:14649497-14649519 ACTCACTGGCTTCATTGCCAGGG + Intergenic
951179519 3:19642748-19642770 ACTCACTGACATCATTTCAAAGG + Intergenic
951283299 3:20779369-20779391 GCTCACAGACCCCACTTCCATGG + Intergenic
953144201 3:40258827-40258849 ACTCACTCATGCCATGCCCAGGG + Exonic
953664371 3:44915536-44915558 CTTCACTGACCCCATCTCCAAGG - Intronic
957881163 3:86214596-86214618 ATTCTCTGAGCCCATTCCAAAGG + Intergenic
958729762 3:97949200-97949222 ACTCACCGCCCCCAACCCCAGGG - Intronic
960009977 3:112823176-112823198 AAGCACTGACCCCATTCCTTTGG + Intronic
960896595 3:122512992-122513014 ACTCACTGTCCCTGTTCTCATGG - Intronic
962196596 3:133369113-133369135 TCCCACTGACCCCAAGCCCATGG + Intronic
963958882 3:151285788-151285810 AACCACTGATCCCATTCACAAGG - Intronic
965440501 3:168707147-168707169 AATCACTGAGTCCATTCCAAAGG - Intergenic
965628689 3:170708217-170708239 CCTCACTTACCTCATTGCCAGGG - Intronic
966534551 3:181017052-181017074 ACTCACTAACCACAGGCCCAGGG + Intergenic
968378940 4:71959-71981 ACTCAATGACCACCCTCCCAAGG - Intronic
971243045 4:24905932-24905954 TCTCTCTTTCCCCATTCCCATGG + Intronic
971292332 4:25355434-25355456 ACTCCCTGACCCCACCCCCATGG - Intronic
971941462 4:33221270-33221292 AAGCACTGACCCCATTCCTTTGG - Intergenic
975254801 4:72220453-72220475 TCTCACTGACTCCATTACCTTGG + Intergenic
977630211 4:99234554-99234576 ACTCACTGAAGCCATTCAGAAGG - Intergenic
980431602 4:132706872-132706894 ACTCATTTACCCAATTCCCCAGG + Intergenic
980958898 4:139455124-139455146 ACTCAGTGTCCCCAGTCCCAGGG - Intronic
981148038 4:141349020-141349042 AGTCTCTGACTCCATTCCCATGG - Intergenic
982748192 4:159127359-159127381 TCTCACTGCCACCATTCTCAGGG + Intronic
984239081 4:177195752-177195774 AGTCACTGTGCCCAGTCCCAAGG - Intergenic
984844321 4:184097200-184097222 GCTCTCAGACCCCATTCCCAAGG - Intronic
985126469 4:186700020-186700042 ACTCACCGTCCCCCTTGCCAGGG - Intronic
985272409 4:188206772-188206794 ACTCACTCACCCCAGTACCATGG - Intergenic
985834640 5:2261472-2261494 CCTCGCTGACCACATGCCCACGG - Intergenic
986093161 5:4531255-4531277 ACTCAGTGCCCCAAGTCCCAGGG - Intergenic
988166106 5:27591044-27591066 CCTCACTCACCCTTTTCCCAGGG + Intergenic
992721785 5:79568076-79568098 TCTCACAGCACCCATTCCCAGGG - Intergenic
994631212 5:102290387-102290409 ACTCACTGACCCCATTCCCAGGG + Intronic
996226101 5:120998466-120998488 CACCACTGACCCCTTTCCCAAGG - Intergenic
996647053 5:125828923-125828945 AATCATTGACCCCTTTGCCAGGG - Intergenic
998250788 5:140550831-140550853 ACTGACTGACCTCAGTCACATGG + Exonic
999199165 5:149803945-149803967 CCTCACTGACCACATGACCAAGG + Intronic
999632781 5:153587795-153587817 ACTCACAGATCCTATTTCCAGGG + Intronic
1000121795 5:158204668-158204690 GCTCACTGCCTCCCTTCCCAAGG + Intergenic
1002045017 5:176536855-176536877 GATCACGGCCCCCATTCCCAGGG + Intronic
1003360896 6:5424064-5424086 ACCCACAGACACGATTCCCAGGG - Intronic
1003916536 6:10791928-10791950 ACTAACAGTCCCCATTCTCAAGG + Intronic
1004599160 6:17130959-17130981 ACTGACTGACCTCATTCCACTGG + Exonic
1005335186 6:24789095-24789117 ACTCCCTGACCCCTTCTCCAAGG - Intergenic
1006188180 6:32192084-32192106 ACATCCTGACCCCATTACCAAGG - Intronic
1015133792 6:129844722-129844744 CCTCACTGTCTCCAGTCCCAGGG + Intronic
1015315477 6:131811708-131811730 CATCACTGCACCCATTCCCAGGG - Intronic
1019338189 7:494900-494922 CCTTGCTGACCCCATTTCCAGGG + Intergenic
1019768948 7:2871299-2871321 GCTCCCTGACCCCAGTCCCTTGG - Intergenic
1019768957 7:2871327-2871349 CCTCCCTGACCCCAGTCCCTTGG - Intergenic
1021195555 7:17670577-17670599 TCTCACTGACCTCAATCTCATGG - Intergenic
1021900068 7:25276357-25276379 ACTCTCTGCCCTCATTTCCAAGG - Intergenic
1023059457 7:36314217-36314239 ACTCCCTGACTCCAGTACCATGG + Intergenic
1026058298 7:67004343-67004365 ACTCACTCACCCCTCCCCCAGGG - Intronic
1026719792 7:72820683-72820705 ACTCACTCACCCCTCCCCCAGGG + Intronic
1026866496 7:73827480-73827502 ACTCTCTGACCCCAAAACCAAGG + Intronic
1032264821 7:130363369-130363391 ATTCACTGGGCCCATTCCCAGGG - Intronic
1032558861 7:132866618-132866640 ACTCACTGACCAGATTCATAAGG + Intronic
1032780125 7:135158656-135158678 ACTCTCTGATCCCAGGCCCAAGG - Intronic
1032909500 7:136413292-136413314 TCTCACTGACCTCATTGCCAAGG + Intergenic
1033133907 7:138768798-138768820 GCCCACTGACCCCGCTCCCACGG - Exonic
1035872109 8:3146825-3146847 ACTCCCAGAGCCCATTCCCATGG - Intronic
1044708354 8:95030693-95030715 AATAACTGACTCCATTCCTAGGG - Intronic
1049018709 8:139939495-139939517 CCTCCCAGTCCCCATTCCCAGGG + Intronic
1049305894 8:141903805-141903827 GCTCACTGCCCCCATTCCTAGGG - Intergenic
1049710758 8:144062351-144062373 ACCCCCAGACCCCATGCCCATGG + Intronic
1051359072 9:16265834-16265856 ACTCAGTGACCCCACTCTCTAGG - Intronic
1052244740 9:26320865-26320887 CCTCACTAACCCCATTACCATGG - Intergenic
1053161898 9:35819085-35819107 CCTCAGTGACCGCATGCCCAAGG + Intronic
1055463430 9:76540691-76540713 AATCACTGACCCCATTCTCTGGG + Intergenic
1056753257 9:89366849-89366871 ACTCAGTGACTCCAGTCCCCTGG - Intronic
1060051992 9:120384292-120384314 TCCCATTGACCCCATTCCCTGGG - Intergenic
1060545574 9:124457280-124457302 TCTCAGTGACCCCCTTCCCCTGG + Intronic
1061394755 9:130337843-130337865 CCCCACTGACCCCACCCCCATGG - Intronic
1061575698 9:131504345-131504367 GCTAAATGACTCCATTCCCAGGG + Intronic
1061640027 9:131946232-131946254 ACACACTGACTTCATTCCTATGG + Intronic
1062696589 9:137878870-137878892 ACTCCCTGCCCCCATCCCTAGGG - Intronic
1186197156 X:7120960-7120982 TCTCTCTGACCCCATGCCAAAGG - Intronic
1187697571 X:21937393-21937415 CATCACTGCCCCTATTCCCATGG - Intergenic
1189713810 X:43844112-43844134 AGTCACTGACTTCATTCTCAGGG + Intronic
1189744960 X:44159439-44159461 ACTCACTGGTAACATTCCCAAGG + Intronic
1190517809 X:51243175-51243197 ACCCACTGACACCACTGCCAGGG - Intergenic
1193440882 X:81538102-81538124 TCTCACTCACCACTTTCCCAAGG + Intergenic
1193858827 X:86639606-86639628 ACCCACTGGCCCCACTTCCAAGG + Intronic
1194111465 X:89839396-89839418 ACCCACTCACCCAACTCCCAAGG - Intergenic
1195953337 X:110301977-110301999 ACTCTATGATTCCATTCCCATGG - Intronic
1196755853 X:119156421-119156443 AATCACTGATTCCAGTCCCAGGG - Intergenic
1199804239 X:151282089-151282111 ACTCACTGAAGCCATTCGGAAGG - Intergenic