ID: 994633827

View in Genome Browser
Species Human (GRCh38)
Location 5:102319998-102320020
Sequence TTGATGGTCTTTACTAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994633824_994633827 20 Left 994633824 5:102319955-102319977 CCAGTTAACACTGTGGTTCTTGT No data
Right 994633827 5:102319998-102320020 TTGATGGTCTTTACTAGATCTGG No data
994633821_994633827 26 Left 994633821 5:102319949-102319971 CCAACCCCAGTTAACACTGTGGT No data
Right 994633827 5:102319998-102320020 TTGATGGTCTTTACTAGATCTGG No data
994633822_994633827 22 Left 994633822 5:102319953-102319975 CCCCAGTTAACACTGTGGTTCTT No data
Right 994633827 5:102319998-102320020 TTGATGGTCTTTACTAGATCTGG No data
994633823_994633827 21 Left 994633823 5:102319954-102319976 CCCAGTTAACACTGTGGTTCTTG No data
Right 994633827 5:102319998-102320020 TTGATGGTCTTTACTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994633827 Original CRISPR TTGATGGTCTTTACTAGATC TGG Intergenic
No off target data available for this crispr