ID: 994639509

View in Genome Browser
Species Human (GRCh38)
Location 5:102389354-102389376
Sequence ACTATGTAGAGGTTTCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994639509 Original CRISPR ACTATGTAGAGGTTTCCCTC AGG (reversed) Intronic
905785299 1:40751266-40751288 ACTATGTAATTTTTTCCCTCTGG - Intronic
907183271 1:52589420-52589442 ACCCTCTAGAGGTTTCCCTTGGG - Intergenic
914795014 1:150913031-150913053 AATATGTAGAGGTTTCAGTGAGG + Intergenic
916299703 1:163259990-163260012 AATATCTAGAGGGTGCCCTCAGG - Intronic
918180692 1:182084243-182084265 ACTATGCAGACACTTCCCTCTGG + Intergenic
920223085 1:204418563-204418585 ACTCTCGAGAGGTTTCGCTCTGG - Intergenic
923246152 1:232134583-232134605 ACCCTCTAGAGGTTTCCCACTGG - Intergenic
923330216 1:232916951-232916973 TGTATGGAGAGGTTGCCCTCTGG + Intergenic
924392557 1:243579111-243579133 ACGATGTTGAGGTTTCTCTATGG + Intronic
924592867 1:245420110-245420132 ACTTTGTAGAGGCATCCCTCTGG + Intronic
1069135714 10:64762319-64762341 CCTATGTATAGGTTTCCTTTTGG - Intergenic
1069251925 10:66278782-66278804 AAAATGGAGAGGTTTCACTCTGG + Intronic
1078154573 11:8788247-8788269 ACTATGCAAAGGGATCCCTCAGG + Intronic
1085483762 11:76844242-76844264 ACCATCTAGAGGTTTCCCATTGG - Intergenic
1086069336 11:82782431-82782453 ACCATCTAGAGGTTTCCCATTGG - Intergenic
1087015299 11:93548863-93548885 ACCCTCTAGAGGTTTCCCACTGG + Intergenic
1087559771 11:99773139-99773161 CTTATGTAGTGGTTTCCCTGAGG - Intronic
1092251506 12:6900877-6900899 ACAATCTAGAGGTTTCCCATTGG + Intronic
1094121078 12:26974818-26974840 ACTATCCAGAGCTTTCCCTTTGG - Intronic
1095240474 12:39852922-39852944 ACTCTCTAGAGGTTTCCCATTGG - Intronic
1095392082 12:41719505-41719527 ACTCTCTAGAGGTTTCCCACTGG - Intergenic
1096569985 12:52516950-52516972 ACGATGTACTGGTTTCTCTCTGG - Intronic
1097873936 12:64625938-64625960 ACTAGGAAGAGGTTTCCCACCGG - Intronic
1098135490 12:67397453-67397475 ACCCTCTAGAGGTTTCCCACTGG + Intergenic
1101620963 12:106387656-106387678 ACTATTTAGACTTTTCCATCTGG + Intronic
1110896611 13:80760731-80760753 ACTCTGTAGAAGTTTCCCATTGG - Intergenic
1117257052 14:53988681-53988703 ACTCTGCAGAGATTTCCCACCGG - Intergenic
1118450952 14:65901706-65901728 ACTCTCTAGAGGTTTCCCATTGG - Intergenic
1120269189 14:82289266-82289288 ATTATTTAGTGGTTTCCCTGGGG + Intergenic
1121338417 14:93090986-93091008 ACCATGGAAAGGTTTCCCTGGGG + Intronic
1124415960 15:29473404-29473426 CCCATGTAGAGGATTCCCTGCGG + Intronic
1127621204 15:60736432-60736454 CCTATGCAAAGGTTTTCCTCTGG - Intronic
1131314586 15:91323071-91323093 TCTATTTAATGGTTTCCCTCAGG + Intergenic
1138067465 16:53957014-53957036 AATATGTAGATGTTTGCTTCAGG + Intronic
1142033776 16:87851585-87851607 ACAACGTGGAGATTTCCCTCTGG - Intronic
1143191778 17:5045187-5045209 AAGATGAAGAGGTTTCACTCAGG - Intronic
1146276115 17:31516861-31516883 ACCATCTAGAGGTTTCCCATTGG + Intronic
1154325661 18:13388953-13388975 GCTGTGTAGATGTCTCCCTCTGG + Intronic
1156105819 18:33659100-33659122 GCTATGTAGCAGTTACCCTCAGG + Intronic
1159359699 18:67383769-67383791 ACTTTGTAGTGGTTGCCCTAGGG - Intergenic
1160100879 18:75918055-75918077 ACTATGAAGGTGTTTCCCACAGG - Intergenic
928726973 2:34185732-34185754 ACTATGTAGAGATTACCCTTAGG - Intergenic
930232479 2:48857293-48857315 ACAATGTAGAGGTTTTCCAGAGG + Intergenic
933660679 2:84925090-84925112 ACCCTCTAGAGGTTTCCCACTGG - Intergenic
933792535 2:85894629-85894651 ACCCTCTAGAGGTTTCCCACTGG + Intergenic
942539341 2:176999158-176999180 AATATGGAGAGGTTTACCTAAGG - Intergenic
943864317 2:192909181-192909203 AATATGTAAGGGTTTCCCACTGG - Intergenic
1172172787 20:32951411-32951433 AATATGTACAGGTTTTCGTCTGG - Intronic
1173154458 20:40595991-40596013 AATAGGTAGAGGTATCCGTCTGG + Intergenic
1175030907 20:55953103-55953125 ATTATGTAAAGGTACCCCTCCGG + Intergenic
1175698806 20:61122824-61122846 ACTTTCTAGAGTTTTCTCTCGGG + Intergenic
1178975765 21:37220066-37220088 ACCCTGTAGAGGTTTCCCATTGG - Intergenic
1181668954 22:24416883-24416905 CCTATCTAGAGGCTTGCCTCGGG + Exonic
1182019779 22:27071685-27071707 ACCATGGAGAGGTTTTCCTCTGG + Intergenic
949280711 3:2343533-2343555 ACCCTCTAGAGGTTTCCCACTGG - Intronic
949678283 3:6482980-6483002 ATTAGGTGGAGGTTGCCCTCAGG - Intergenic
955773806 3:62412820-62412842 ACTATCTAGGGGTCTCTCTCTGG + Intronic
963045092 3:141096216-141096238 ACTATTTAGCTGTTTCCCCCTGG - Intronic
964300711 3:155282280-155282302 ACTCTCTAGAGTTTTCCCACTGG - Intergenic
964554856 3:157925828-157925850 ACTGTTTAGAGGTTTCCCATTGG + Intergenic
964749598 3:160042196-160042218 ACCCTCTAGAGGTTTCCCACTGG + Intergenic
965429542 3:168569126-168569148 AATTTCTAGAGGTTTTCCTCTGG + Intergenic
967201387 3:187075449-187075471 AATTTGGAGAGCTTTCCCTCTGG - Intronic
967216277 3:187213174-187213196 ACTTTGTAGAGGTCTCCTTTGGG + Intergenic
967398907 3:189039097-189039119 ACCCTGCATAGGTTTCCCTCCGG - Intronic
970097589 4:12481345-12481367 ATTCTGGAGAGGTTTCCCTAAGG + Intergenic
970102971 4:12546243-12546265 TCAATGTACATGTTTCCCTCTGG + Intergenic
976695521 4:87916010-87916032 ACTATCTAGCAGTTTCTCTCTGG - Intergenic
978484736 4:109238980-109239002 CCTATGAAGGGGTTCCCCTCGGG - Intronic
979624455 4:122829126-122829148 ACTATGTAGAGGTTAGCCAGTGG + Intronic
981172636 4:141642549-141642571 CTTCTGTAGAGGTTTCCCACTGG + Intronic
982058001 4:151572485-151572507 ACTTGGTAGAGGTCTCCCTGTGG + Intronic
986238284 5:5933086-5933108 ACTCTCTAGAGGTTTCCCATTGG - Intergenic
994639509 5:102389354-102389376 ACTATGTAGAGGTTTCCCTCAGG - Intronic
997786269 5:136716855-136716877 TCAATGTATTGGTTTCCCTCTGG - Intergenic
998472826 5:142396660-142396682 ACTCTCTAGAGGTTTCCCATCGG + Intergenic
999226153 5:150026631-150026653 ACTATGTAGAGATTGCGCTTTGG + Intronic
1000086357 5:157890884-157890906 ACCCTCTAGAGGTTTCCCACTGG + Intergenic
1000959588 5:167584301-167584323 ACTCTCTAGAGGTTTCCCATTGG + Intronic
1004654972 6:17650974-17650996 ACTATTTAGTGGTTTCTCTTGGG - Intronic
1004706215 6:18126192-18126214 ACTGCCTAGAGGTTTCCCACTGG + Intergenic
1010915565 6:81613833-81613855 ATTATGTAAAAGTTTCCCTAGGG + Intronic
1019842689 7:3464146-3464168 TGTATGTATAGGTTTCACTCAGG - Intronic
1021809407 7:24388843-24388865 ACAATGTAAATGTTTCCTTCAGG - Intergenic
1027255713 7:76429566-76429588 ACGATGGACAGGTTTCCCACGGG - Exonic
1032252666 7:130271432-130271454 ACTCTTTAGAGGTTTCCCATTGG + Intronic
1033581099 7:142736565-142736587 CCTATGTAGAGGTCTTCTTCAGG + Intergenic
1035907318 8:3527474-3527496 ACTATGAAAAGGTTTCCCAGGGG + Intronic
1037017513 8:13926697-13926719 ACCCTCTAGAGGTTTCCCACTGG - Intergenic
1039383711 8:37111258-37111280 ACTCTCTAGAGGTTTCCCATTGG + Intergenic
1041847125 8:62342364-62342386 ACTATATAGACATTTCCATCAGG - Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1043683703 8:83063543-83063565 ACCATTTAGAGGTTTCCCATTGG - Intergenic
1044271227 8:90246546-90246568 ACTATGTAAATGTTTTCCTCTGG - Intergenic
1044876537 8:96673304-96673326 ACCATCTAGAGGTTTCCCATTGG + Intronic
1048152326 8:131905482-131905504 ACTATGTAAAGATTTGCCACAGG - Intronic
1052487955 9:29127122-29127144 ACTCTCTAGAGGTTTCCCGTTGG - Intergenic
1052488509 9:29132527-29132549 ACTCTCTAGAGGTTTCCCATTGG - Intergenic
1052899729 9:33782053-33782075 CCTATGTAGAGGTCTTCTTCAGG + Intronic
1056196977 9:84238466-84238488 TTTATATGGAGGTTTCCCTCTGG + Intergenic
1062704689 9:137931286-137931308 ACTCTCTAGAGGTTTCCCATTGG + Intronic
1062706493 9:137947074-137947096 ACTCTCTAGAGGTTTCCCATTGG + Intronic
1187432104 X:19234518-19234540 ACTCTCTAGAGGTTTCCCATTGG - Intergenic
1188245788 X:27834505-27834527 ACTAGGTGGAGATTTCTCTCTGG - Intergenic
1189114616 X:38329849-38329871 ACCCTCTAGAGGTTTCCCACTGG - Intronic
1189299869 X:39944654-39944676 ACTGTGTCTGGGTTTCCCTCAGG - Intergenic
1189851295 X:45178710-45178732 ACTTTGTAAAAATTTCCCTCAGG + Intronic
1190408898 X:50115052-50115074 ACTCTCTAGAGGTTTCCCATTGG - Intergenic
1191607229 X:63076123-63076145 ACTATGGAGACATTTCCCTTTGG + Intergenic
1195109874 X:101637188-101637210 ACTATTCAGAGGTTTCTCTTGGG - Intergenic
1195120784 X:101749825-101749847 ACTATTAAGAAGTTTCTCTCAGG + Intergenic