ID: 994643002

View in Genome Browser
Species Human (GRCh38)
Location 5:102433662-102433684
Sequence GGTCACAACACTCCAATGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 8, 2: 28, 3: 82, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994642992_994643002 30 Left 994642992 5:102433609-102433631 CCTCAAGGTAGAAACATGCTGTG 0: 1
1: 0
2: 1
3: 16
4: 188
Right 994643002 5:102433662-102433684 GGTCACAACACTCCAATGGACGG 0: 1
1: 8
2: 28
3: 82
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994643002 Original CRISPR GGTCACAACACTCCAATGGA CGG Intronic
902230122 1:15022462-15022484 GGTCACAACAAGCAAATGGTAGG + Intronic
903542895 1:24106922-24106944 GGTCACACCACTGGAATGTAGGG + Intronic
905538953 1:38745031-38745053 GGTCAGGACACTCAAATGGTGGG + Intergenic
906003642 1:42449110-42449132 TGTCATAACACTAAAATGGATGG + Intronic
906888967 1:49686282-49686304 GGCAACAACATTCCCATGGAGGG - Intronic
906943698 1:50277642-50277664 GTTCACAATACTCCCTTGGATGG + Intergenic
907027165 1:51131849-51131871 GGTCACTACACTCTAATGGGTGG - Intronic
908115354 1:60935052-60935074 GTTCACGACACTCCTATGGCTGG + Intronic
908667720 1:66510800-66510822 GGTCATTACCCTCCAATGGGTGG - Intergenic
908935666 1:69373352-69373374 GGTCACAACATTCTGATGGGCGG + Intergenic
909203709 1:72725900-72725922 GGTCACTACACTCCAATGGATGG - Intergenic
910657154 1:89631464-89631486 GGTCACAACCCTCCTGTGGAGGG - Intergenic
911311529 1:96297842-96297864 GGTCACTACACTCCAATGAGTGG + Intergenic
912594832 1:110864313-110864335 GGCCACAACACTCCAATGGGTGG - Intergenic
913179533 1:116308131-116308153 GGACAGAACACTTCAATGGCAGG + Intergenic
913349660 1:117843187-117843209 GGTCACTACACTTCAATGGGTGG - Intergenic
916392158 1:164342525-164342547 GGCAACAACACTCCAATGGGAGG - Intergenic
917524530 1:175775243-175775265 GGTCACAACAATCTGATGGGTGG - Intergenic
918856591 1:189763311-189763333 GGTTAGAACACTCCTAGGGAGGG + Intergenic
918949052 1:191110999-191111021 GGGCACAACATTGCAATGGGTGG + Intergenic
919568396 1:199218074-199218096 GGTCACTACTCTCCAATAGGTGG + Intergenic
921104281 1:211960050-211960072 GGTTACTACACTCCAATGGGTGG - Intronic
921777021 1:219112634-219112656 GGTTGCTACACTCCAATGGGTGG - Intergenic
921800624 1:219398953-219398975 AGTCACTACACTCCAATGGATGG + Intergenic
1063275115 10:4557566-4557588 GGTCACTCCACTCCAAAGGGTGG + Intergenic
1068285536 10:54929325-54929347 GGTCACTACACTTCAATGGGTGG + Intronic
1069072061 10:63999052-63999074 GGTCACTACACTCTGATGCATGG - Intergenic
1069314962 10:67086912-67086934 AGTCACAACAGTCCACTGGAGGG - Intronic
1069334025 10:67327638-67327660 GGTCAGTACACTCCAACGGGTGG + Intronic
1069805896 10:71124868-71124890 GGTCACTACACTCCAATGGGTGG + Intergenic
1071358010 10:84817867-84817889 GGCCACAACACTCTAATGGGTGG + Intergenic
1072839332 10:98753597-98753619 GGCCACAACACTCTGATGGAAGG - Intronic
1076031487 10:127162971-127162993 GGTTAGAACAGTCCCATGGAAGG - Intronic
1077841619 11:5982061-5982083 GGCAACAACAGTCCAGTGGAGGG + Intergenic
1078930184 11:15906501-15906523 TTTCACAACACTCCCCTGGAGGG + Intergenic
1080009549 11:27443912-27443934 GGACAAAATGCTCCAATGGATGG + Intronic
1080057281 11:27919268-27919290 TGTGACAACATTCCCATGGAGGG - Intergenic
1083006419 11:59351004-59351026 GGTCACTACACTCTGATGGGTGG + Intergenic
1084925768 11:72510331-72510353 GGCCACAACACTCCAATGAGTGG + Intergenic
1085731456 11:79002398-79002420 GGCCACAACACTCCAATGGGTGG - Intronic
1085812810 11:79700718-79700740 GGTCACAACACTCTGATTGGTGG - Intergenic
1085856374 11:80180985-80181007 GGTCACTACACTTCTATGGGTGG + Intergenic
1088201508 11:107340273-107340295 GAGCACAGCACTCCAATGTAAGG - Intronic
1090162432 11:124509984-124510006 GGTCACTACACTCTGATGGGTGG + Intergenic
1090217570 11:124983680-124983702 GGTCACAACACACTGATGGATGG + Intronic
1090684585 11:129100983-129101005 GGTCACTACACTCCAATGGGTGG - Intronic
1091529228 12:1338950-1338972 GGTCACTACACTCTAATGGGTGG + Intronic
1092333694 12:7608882-7608904 GGTCACAACACTTTGATGGATGG - Intergenic
1092678716 12:10952900-10952922 GGCCACAACACTCTGAAGGATGG - Intronic
1093490789 12:19701519-19701541 GGCCACAACACTCCAATGAAGGG - Intronic
1094289703 12:28833340-28833362 GGTCACAACACTCTGATGGGGGG - Intergenic
1098889932 12:75999582-75999604 GGCCTCAACACTTCAGTGGAGGG - Intergenic
1099394613 12:82121824-82121846 GGTCAAAACACTCCAATGGGTGG - Intergenic
1099585066 12:84505145-84505167 GGACACAAGACTACAAAGGAAGG - Intergenic
1100791299 12:98133115-98133137 GTTTACAACAGTCCAAGGGAAGG - Intergenic
1101471146 12:104998582-104998604 GGTCAGAACACTTCAATGGGTGG + Intronic
1107389200 13:39945575-39945597 GGTCACAACACTCTCATGGGTGG - Intergenic
1108775683 13:53762188-53762210 GGTCACAATACTCTGATGGGTGG - Intergenic
1108839453 13:54593815-54593837 GGTCACAATACTTCAACAGATGG - Intergenic
1109476557 13:62886954-62886976 GGCCACAACAATCCAATGGGTGG + Intergenic
1109569229 13:64164432-64164454 GGCCACAACACTCTGATGGATGG + Intergenic
1111817568 13:93173046-93173068 GGCAACGACACTCCGATGGATGG - Intergenic
1114933572 14:27506320-27506342 GGTCACTACACTTCAATGGGTGG + Intergenic
1117638837 14:57775385-57775407 GGTTCCAAGACTCCAATGGCTGG - Intronic
1118448723 14:65877208-65877230 GGTCACTACACTCCGATGGGTGG + Intergenic
1121560453 14:94871174-94871196 GGACACAACATTTCAACGGAAGG - Intergenic
1123875656 15:24621603-24621625 GGCCAGAACACTCCAATGGGTGG + Intergenic
1129570902 15:76682647-76682669 GACCACAACACTCTAATGGGTGG - Intronic
1129572152 15:76699725-76699747 GGCAACAACACTTCAATGGCGGG + Intronic
1129931270 15:79412806-79412828 GGTCACAACACTCCAATGGGTGG - Intronic
1132042372 15:98536119-98536141 GGCCACAACACTCCAGTGGGGGG - Intergenic
1133489027 16:6249195-6249217 GGGACCAACACACCAATGGAAGG + Intronic
1136931910 16:34426199-34426221 GGCCACAACACTCTGATGGGTGG + Intergenic
1136972662 16:34985616-34985638 GGCCACAACACTCTGATGGGTGG - Intergenic
1138263199 16:55640414-55640436 GACCACAAGACTCCTATGGATGG + Intergenic
1138458356 16:57133832-57133854 CCTCACAACACCCCAATGGAAGG - Intronic
1138976415 16:62213824-62213846 GGTCACCACACTCCAATGGGTGG + Intergenic
1141053590 16:80795469-80795491 GGTCACACCACTCCAGTGAAAGG - Intronic
1141131775 16:81442471-81442493 GGGCACAAAACTCCAGTAGAAGG - Intergenic
1142021263 16:87784158-87784180 GGTCACAACACGACGATGGGAGG - Intergenic
1150533702 17:66013632-66013654 GGCCACAACACTCCAACGAGTGG + Intronic
1150940502 17:69688055-69688077 GGTCACAACACTCTGATGGGTGG + Intergenic
1154019277 18:10648335-10648357 GGTCACTACACTCCAATGGGTGG - Intergenic
1154184941 18:12174898-12174920 GGTCACTACACTCCAATGGGTGG + Intergenic
1155844958 18:30694840-30694862 GGTCACAACACTCCAGTGGATGG + Intergenic
1159170396 18:64758844-64758866 AGCCACACCACTCCAATGGGTGG - Intergenic
1159905971 18:74092782-74092804 GGTCACAACACTCTGATGGGTGG + Intronic
1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG + Intergenic
1163265225 19:16216835-16216857 GGTCACAACACTCCAATGGGTGG + Intronic
1166585934 19:43949055-43949077 GGTCACTGCACTACAATGGATGG + Intergenic
925304913 2:2841297-2841319 GGACATACCACTCCAATGTATGG + Intergenic
929005316 2:37387793-37387815 TGTCAAAACAATCCACTGGAGGG - Intergenic
930929366 2:56861975-56861997 GGCAACAACACTCTGATGGAAGG + Intergenic
930930474 2:56875624-56875646 GGTCACCAAACTCCAATGGATGG - Intergenic
931921259 2:67018555-67018577 TGCCACAACACTCCAATGGGTGG - Intergenic
933555171 2:83822989-83823011 GGTCACTACACTCTGATGGGTGG + Intergenic
934219023 2:90064625-90064647 GGTCACAACACTTCTGTGGGTGG + Intergenic
934586799 2:95506917-95506939 CCTCACGACACTCCAAAGGAGGG + Intergenic
934946748 2:98547929-98547951 CGTCACAAGAATCCCATGGATGG + Intronic
934996553 2:98967047-98967069 GGTCACAACACTACAATGGCTGG + Intergenic
936703203 2:115038719-115038741 TGTCACAACCCTGTAATGGAGGG + Intronic
936812110 2:116414176-116414198 GGCCACAACACTCCAGTGGGTGG - Intergenic
940476348 2:154167820-154167842 GGTACCAACAATCCTATGGATGG + Intronic
941054996 2:160777231-160777253 GGCAACAACACTCCAATGGAGGG - Intergenic
942855460 2:180541057-180541079 GTTCAAAACACTGCAATGGCTGG - Intergenic
944436599 2:199696391-199696413 GGCAACAACACTTCAATGGCAGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1169560915 20:6799861-6799883 GGTGTCATCATTCCAATGGAAGG + Intergenic
1170567916 20:17617087-17617109 GGTCACCTCACTCCCAGGGAGGG - Intronic
1174091939 20:48056214-48056236 GGTAACCACCCTCCAATGGCTGG + Intergenic
1177043790 21:16145495-16145517 GGTCACTACACTTCAATGAGTGG + Intergenic
1178060510 21:28849089-28849111 GGCCACAACACTCTGATGGGTGG - Intergenic
1184528152 22:45037658-45037680 GGTGACAGCATTCCAATGGCAGG + Intergenic
949743499 3:7263327-7263349 GGTCACAACACTTAGATGGGTGG + Intronic
951822525 3:26828007-26828029 GGTCACTACACTCTGATGGGTGG - Intergenic
953104336 3:39861081-39861103 GGTCACAACACCCTTATGGGTGG - Intronic
954407093 3:50351245-50351267 GGTCACAACATGCCAGTCGACGG - Exonic
954509229 3:51106949-51106971 GGTCACAACACTCTGCTGGGTGG - Intronic
956033177 3:65061454-65061476 GGTTCCATCACTCTAATGGAAGG + Intergenic
956371886 3:68571662-68571684 AGTCACAATACTCCAATGGGTGG - Intergenic
959041286 3:101425250-101425272 GGTCACTACTCTCCAATGGGTGG - Intronic
959169881 3:102831314-102831336 GGTCACAACACTTCAATGGTTGG - Intergenic
959291097 3:104475215-104475237 GTTCACAACACTCTGATGGGTGG - Intergenic
959421696 3:106136268-106136290 GGTCACTACATTCCAATGGGTGG - Intergenic
960012659 3:112850021-112850043 GGTTACAACACTCTAATGGGTGG - Intergenic
961988147 3:131158876-131158898 GGTCACTACACTCTGATGGATGG - Intronic
962655630 3:137541893-137541915 GGCCACAACATTCCAATAGGTGG + Intergenic
964142809 3:153422563-153422585 GGTCACTACACTCTGATGGGTGG - Intergenic
964282924 3:155086592-155086614 TTTCACCACACTCCAATTGATGG - Intronic
964296434 3:155239409-155239431 GGTCACAACACTCCAATAGGTGG + Intergenic
965181940 3:165415154-165415176 GGTCACTACACTCTAATAGGTGG - Intergenic
966714191 3:182999805-182999827 GGTCACTACACTCTGATGGATGG + Intergenic
968540463 4:1165701-1165723 GGACACAACACTCCAGTCAAAGG - Intergenic
968598114 4:1495753-1495775 GGTCTCCACACTCCAAGGCAGGG - Intergenic
970221192 4:13813180-13813202 GGTCTCAAGACTCCAAGGGAGGG - Intergenic
971884927 4:32432232-32432254 GGTCACAACATTCCAAGGGGTGG - Intergenic
973673722 4:53242220-53242242 GGTCACAACACTCTGATGGGTGG - Intronic
973849731 4:54949071-54949093 GGTCACACCACTCCAATCATTGG + Intergenic
974543987 4:63275987-63276009 GGCCCCAAAAATCCAATGGAAGG - Intergenic
974723653 4:65773069-65773091 GGTCACTACACTCCAATAGGTGG + Intergenic
975909351 4:79248948-79248970 CATCACAACATTCCAATGGGTGG - Intronic
976948407 4:90798906-90798928 GGTCACAACACTCTGATGGGTGG + Intronic
977696590 4:99972325-99972347 ATTCACAACACTCCAATGGGTGG - Intergenic
978689014 4:111484110-111484132 GGTCACTACACTACAATGGGTGG - Intergenic
979158495 4:117429092-117429114 AGTTACTACACTCCAATGGATGG + Intergenic
980938189 4:139246316-139246338 TGTCCCAACAGTCCAAAGGAGGG + Intergenic
981454008 4:144932977-144932999 GGTCACTACACTTCTATGGGTGG + Intergenic
981466296 4:145076185-145076207 GGCAACAACACTCCAATGAGGGG - Intronic
982878980 4:160686501-160686523 GGTCACAACACTCTGATGGGTGG - Intergenic
983413419 4:167425437-167425459 GGCCACAACACTCTGATGGGTGG - Intergenic
986229498 5:5849833-5849855 GGCAACAACACTCCGATGGGGGG - Intergenic
986244772 5:5997508-5997530 GGCAACAACACTCCAATAGAGGG + Intergenic
988324017 5:29738224-29738246 GGCCACAGCAGTCCATTGGATGG - Intergenic
988635703 5:32981685-32981707 GGTCAAAACACTGAAAAGGAAGG + Intergenic
989216411 5:38908502-38908524 GGCCACAAAACTCCAATGAGTGG - Intronic
989481771 5:41939120-41939142 GGTCCAAACACTCCAATAGAAGG + Intronic
993228682 5:85204133-85204155 GGCCACAATACTCCTATGGGTGG + Intergenic
994573016 5:101537813-101537835 GGCCACAACACTTCAATGGTTGG - Intergenic
994643002 5:102433662-102433684 GGTCACAACACTCCAATGGACGG + Intronic
995488070 5:112659053-112659075 GGCCACAACACTCCAATGAGTGG - Intergenic
995896161 5:117013495-117013517 GGTCACTACACTCTGATGGGTGG + Intergenic
996451427 5:123629494-123629516 TGTCACAGCACTCTGATGGATGG - Intergenic
997021551 5:130008230-130008252 GGCAACAACACTCCAATGGGGGG - Intronic
997182154 5:131841260-131841282 GGTCTCTACAATCCAATGGGTGG + Intronic
998755893 5:145379230-145379252 GGTCACTGCACTCCAATGGGTGG + Intergenic
999504069 5:152177426-152177448 GGTCAGGACACACAAATGGATGG - Intergenic
1000521453 5:162299808-162299830 GGTAACAACACTCTGATGGGGGG + Intergenic
1004090463 6:12495004-12495026 GGTCACAACATTCTGATGGGTGG - Intergenic
1004719155 6:18250531-18250553 AGGCCCAACACTCCAATCGAAGG + Intronic
1004834100 6:19511426-19511448 GGTCACTACACTCCAATGAGTGG + Intergenic
1006253064 6:32807121-32807143 GGTCACTACACTCCAATGAGTGG + Intergenic
1011549826 6:88521018-88521040 GCTCAAAACCCTCCAATAGAAGG - Intergenic
1011764313 6:90603680-90603702 GATCACAAAACTCCTGTGGAGGG - Intergenic
1012499385 6:99871823-99871845 GGTCCCAACACTAAACTGGAAGG - Intergenic
1012668928 6:102015738-102015760 GGTCACAACACTCTGAAGGGTGG - Intronic
1014854402 6:126381736-126381758 GGTCACAACACTATGATGGGCGG - Intergenic
1015246927 6:131085333-131085355 GGTCACTACACTTCAATGGGTGG - Intergenic
1015861434 6:137684674-137684696 GATCACATCACTCCAAGAGATGG - Intergenic
1016075251 6:139788266-139788288 TGTCACAACACTCTGATGGGTGG + Intergenic
1016237694 6:141887819-141887841 GTCCACAACACTCCAATTGGTGG - Intergenic
1016453556 6:144209091-144209113 GGTCACTACACTCCAGTTGGTGG + Intergenic
1016663702 6:146610744-146610766 GGCAACAACACTCCAATGGGGGG + Intronic
1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG + Intronic
1018603663 6:165575208-165575230 GGTCACAAAACTCGAATGATTGG - Intronic
1021425710 7:20496689-20496711 GGTCACAACACTTCAATGGGTGG - Intergenic
1022877877 7:34553345-34553367 GGTCACAACACTCCAATGGGTGG - Intergenic
1024085291 7:45887584-45887606 GATCACAGCTCTCCACTGGAAGG + Intergenic
1024356843 7:48422353-48422375 GGTCACAGCACTCCAGTCAAAGG - Intronic
1028177373 7:87674111-87674133 GGTCACAATACTCCTATGGGTGG + Intronic
1028639926 7:93030284-93030306 GGGCACAACACTGCAATGAGTGG - Intergenic
1031294452 7:119983899-119983921 GGTCACAACACTCTGATGGGTGG - Intergenic
1033442587 7:141393829-141393851 GGTTACAACACTCCATTGTGGGG + Intronic
1034366360 7:150551887-150551909 GGTAACAACACTCCAATGAGTGG - Intergenic
1037155566 8:15694822-15694844 GGTCACAACACTCCCATGAGTGG + Intronic
1037373496 8:18205082-18205104 GGTCACTACACTCCGATGGGTGG + Intronic
1038294050 8:26274711-26274733 GGTGACAACACTCCAGCTGAGGG - Intergenic
1039289427 8:36077773-36077795 GGTTACTACCCTCCAATGGGTGG - Intergenic
1039638558 8:39193899-39193921 GGCCACAACATTCCAATAGGTGG + Intronic
1040729008 8:50419899-50419921 GGGCACAACAGCACAATGGACGG + Intronic
1040760274 8:50833170-50833192 GGTCACAACACTCGGATGGGTGG - Intergenic
1041005211 8:53491509-53491531 GGACACAACACTCCAATCTCTGG + Intergenic
1041404576 8:57483783-57483805 GGTCACTAAACTCTGATGGATGG - Intergenic
1041429147 8:57759303-57759325 GGCCACAACACTCCAATGGGTGG - Intergenic
1041911694 8:63095744-63095766 GGTCATAAGACTCAAATGGAAGG + Intergenic
1042413473 8:68491948-68491970 GGTCACACCACCCTACTGGAGGG - Intronic
1042752155 8:72170113-72170135 GGCCACAACACTCTGATGGGTGG + Intergenic
1042976633 8:74477690-74477712 GGTCACAACACTCTAATGGGTGG + Intronic
1043131802 8:76472103-76472125 GGCCACAACACTTCAATGGGTGG + Intergenic
1043656645 8:82675068-82675090 GATCACTACACTCCAATGGGTGG - Intergenic
1043738418 8:83775837-83775859 GGTCACAACACTCCCATGGGTGG - Intergenic
1044793588 8:95872882-95872904 GGTCACTACACTCTAATGGGTGG - Intergenic
1048029396 8:130616682-130616704 GGTCACTACACTCCAATGGATGG - Intergenic
1048119381 8:131563045-131563067 GGTCACAATGCTACAATGGGTGG + Intergenic
1048544177 8:135370724-135370746 GGTCACTAAACTACATTGGAGGG + Intergenic
1049128202 8:140811142-140811164 GGTCACTACACTCCAATGGGTGG - Intronic
1050475418 9:6035344-6035366 GGTCACAACACTGTGATGGATGG - Intergenic
1050965360 9:11795074-11795096 GGCAACAACACTCTAATGAAAGG + Intergenic
1051110335 9:13627897-13627919 AGTCACGACACTCCAATGGGTGG - Intergenic
1052591187 9:30497757-30497779 GGTTACAACATTCCGATGGGTGG + Intergenic
1052986316 9:34490704-34490726 GCTCCCAAAACTCCACTGGAAGG + Intronic
1053542837 9:38993074-38993096 GGTCACAACACTCTGATGGGTGG + Intergenic
1053807283 9:41816591-41816613 GGTCACAACACTCTGATGGGTGG + Intergenic
1054623309 9:67370836-67370858 GGTCACAACACTCTGATGGGTGG - Intergenic
1054965999 9:71027058-71027080 GGTCACAACACTTTGATGGGTGG - Intronic
1055215418 9:73854152-73854174 GCTAACAACACTTTAATGGAAGG - Intergenic
1056572624 9:87828878-87828900 GGTCACAACACTTGTATGGGTGG - Intergenic
1057638479 9:96794825-96794847 GGTCACAACACTCTGATGGGAGG + Intergenic
1060211983 9:121716183-121716205 GGTCACAGGCCTCCAAGGGATGG + Intronic
1060336670 9:122730286-122730308 GGTCACTACACCTCTATGGATGG - Intergenic
1185853924 X:3515593-3515615 GGTTACAACCCTGCAAAGGAAGG + Intergenic
1187644242 X:21329038-21329060 GGTCACAACTTTCCAATTGGTGG - Intergenic
1188493148 X:30756696-30756718 TGTCACAACACTCTGATGGATGG - Intergenic
1188797100 X:34480927-34480949 GGTCACAACACTTCAATGGGTGG + Intergenic
1188837727 X:34978731-34978753 GGCCACAACACTCCAATGGGTGG - Intergenic
1189327339 X:40120779-40120801 GGTCACAAAATTACCATGGATGG + Intronic
1189558035 X:42165636-42165658 GGTCACAACACTCCAATGGGTGG + Intergenic
1191207801 X:57852976-57852998 GTTCAAAACACTCCGATGGGTGG + Intergenic
1191722710 X:64248138-64248160 GGCCACAACACTCTAAAGGCTGG + Intergenic
1191729012 X:64314178-64314200 GGTCACTACACTCTAATGAGTGG + Intronic
1191816841 X:65254297-65254319 GGCCACAACAGTGCAATGGCTGG - Intergenic
1192766738 X:74147219-74147241 GGTCACAATACTCCAATGGCTGG - Intergenic
1192927894 X:75776014-75776036 GGTTACAACACTCCAATGGGTGG + Intergenic
1192982937 X:76366674-76366696 GGTCACAATAATCCAAAAGATGG + Intergenic
1193270039 X:79517961-79517983 GGAAACAACACTCTAATGGGAGG - Intergenic
1193401950 X:81055477-81055499 GGCCACAACACTCCCATGGTGGG - Intergenic
1193518770 X:82503334-82503356 GGCCACAACATTCCAATAGGTGG + Intergenic
1193557479 X:82973908-82973930 GGTCACAGAACTCCAATAGCTGG - Intergenic
1193635309 X:83943340-83943362 GGTCAGAACACTTAAATGGGTGG + Intergenic
1193638761 X:83985341-83985363 AGCCACAACACTCCAAAGGGTGG - Intergenic
1193736231 X:85159923-85159945 GGTCCCAGAACGCCAATGGATGG - Intergenic
1193749558 X:85326078-85326100 GGTCACAACACTCCTATGGGTGG + Intronic
1194519476 X:94901286-94901308 GATCACAACACCCCAATGTGTGG + Intergenic
1194851528 X:98875815-98875837 GGCCACAAAACTCCAATGCATGG + Intergenic
1194872765 X:99153424-99153446 AGGAACAACACTCCAATGGGGGG - Intergenic
1195533227 X:105981900-105981922 GGTCACCACATTCTGATGGATGG + Intergenic
1195544464 X:106099923-106099945 GGTCACAACACTCCGATGGCTGG + Intergenic
1195586198 X:106567530-106567552 GGTCACGACACTCCAATGGGTGG - Intergenic
1196584177 X:117409876-117409898 GGTCACAGCACTCCAATGGGTGG - Intergenic
1197141567 X:123122546-123122568 GGTCACAACACTCTAATAGGTGG - Intergenic
1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG + Intergenic
1197551515 X:127898104-127898126 GGTCACAACAGTCTAATTGGTGG - Intergenic
1197570779 X:128147759-128147781 GGTCACAATACTGTAATGGGTGG - Intergenic
1198758902 X:140011168-140011190 AGTCACAACAGTCCAATGGGCGG + Intergenic
1198779842 X:140222413-140222435 AGTCACAACAGTCCAATGGGCGG - Intergenic
1198890655 X:141392115-141392137 GGTCACAGCACTCTGATGGGTGG + Intergenic
1198891520 X:141402677-141402699 GGTCACTACACTCTGATGGTTGG + Intergenic
1199216606 X:145266360-145266382 GGTCACAATAATCCAATGGGTGG - Intergenic
1199407975 X:147485248-147485270 GGTAACAACACTCTGATGGGAGG + Intergenic
1199640849 X:149859282-149859304 GGTCACCACACTCCCATGAGTGG - Intergenic
1199707089 X:150437126-150437148 GGTCACAACACTGCAATGGATGG + Intronic
1199786939 X:151114311-151114333 GTCCACAACACTCCAATGGGTGG + Intergenic
1200653140 Y:5867216-5867238 GGTCACAACATTCTAATGAGTGG + Intergenic
1200809537 Y:7468773-7468795 GGTTACAACCCTGCAAAGGAAGG - Intergenic
1201247581 Y:12020997-12021019 CATCACAACACTCCACTGGCAGG - Intergenic
1201968276 Y:19762536-19762558 GGTCACAACACTCTAATGATTGG + Intergenic