ID: 994643150

View in Genome Browser
Species Human (GRCh38)
Location 5:102435508-102435530
Sequence CTTTGAGTATATAAGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994643147_994643150 3 Left 994643147 5:102435482-102435504 CCAAGAAGCAGAAAGGAAAGTCC 0: 1
1: 0
2: 3
3: 34
4: 415
Right 994643150 5:102435508-102435530 CTTTGAGTATATAAGGTAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994643150 Original CRISPR CTTTGAGTATATAAGGTAGC AGG Intronic
902910041 1:19589083-19589105 CTCTGAATATATAATGTAGCAGG - Intergenic
908228386 1:62079318-62079340 TTTTGAGAATATAAGGTTGGAGG - Intronic
908425071 1:63999201-63999223 CTTTGAGTATCCAAGTTTGCAGG + Intronic
909625832 1:77714934-77714956 CTATGAGTATATAATGTATTTGG - Intronic
918530936 1:185521656-185521678 CTTTGAGAAAATAAAGTAGGAGG - Intergenic
921138209 1:212281964-212281986 TTTTGAGTAAATAAGGTATCTGG - Intergenic
921281166 1:213569439-213569461 CTAAGAGTATAGAAGGAAGCTGG - Intergenic
923948839 1:238924288-238924310 CTTTGCAGATATCAGGTAGCAGG + Intergenic
1064753036 10:18551513-18551535 TTTTGCTTATATGAGGTAGCTGG - Intronic
1064927916 10:20590454-20590476 CTTTGAGTAGATGAGGAAGTGGG - Intergenic
1068220487 10:54038896-54038918 CTTTGAGGTAATAATGTAGCTGG - Intronic
1069276792 10:66601843-66601865 CTTGGAGTATATAAGCTGGTTGG - Intronic
1072455743 10:95574246-95574268 CTTTGAATTTATGTGGTAGCCGG + Intergenic
1075674091 10:124283759-124283781 CTTTCAGTCTAAAAGGTTGCTGG + Intergenic
1075948709 10:126459369-126459391 CTTTGTGTAAAGAAGGTAACAGG + Intronic
1079478004 11:20851467-20851489 CTCTTAATATAAAAGGTAGCCGG - Intronic
1080732143 11:34967912-34967934 CTTTGACTATATAATGTATATGG + Intronic
1084133792 11:67158730-67158752 CTTTGGGCATGTAAGGTAGAAGG - Intronic
1087509402 11:99071064-99071086 CTTAGAGTATACAATGTATCAGG + Intronic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1092000403 12:5027073-5027095 ATTTAAGTATATAACATAGCAGG + Intergenic
1097183822 12:57185660-57185682 CTCTGAGTAGAGCAGGTAGCCGG - Exonic
1097315947 12:58171715-58171737 CTTCCATTATATAAGGTAGAAGG - Intergenic
1099383743 12:81988677-81988699 CCTTGAGTATAGAAGTTATCTGG + Intergenic
1100893296 12:99150492-99150514 CTTTGAGGATAAAAGACAGCAGG + Intronic
1107266823 13:38565878-38565900 TTATGAGTATTTAATGTAGCTGG - Intergenic
1107503188 13:41002075-41002097 CTGTGAGTATATAAGGTGAGGGG + Intronic
1111264045 13:85783422-85783444 CTTTGGGAAAATGAGGTAGCAGG + Intergenic
1111478271 13:88783680-88783702 CTTTGAGTATATGGGATTGCTGG + Intergenic
1111583597 13:90255830-90255852 CTTAGTGTAGCTAAGGTAGCAGG - Intergenic
1117167700 14:53055444-53055466 GTTTTAGAATATAAGATAGCTGG - Intronic
1117262648 14:54052091-54052113 ATTTGTGTATATCAGGTACCTGG + Intergenic
1124556969 15:30735462-30735484 CTTTGGGTATATAAAGTAATGGG - Intronic
1126510968 15:49474227-49474249 TTTTTAGTAAATAATGTAGCTGG + Intronic
1129750167 15:78057141-78057163 CTTTGAGTATTAAATGTAACTGG + Intronic
1130721936 15:86396350-86396372 CTTTGTTTATAGAAGATAGCTGG - Intronic
1138175612 16:54895708-54895730 CTTTGGGGAAACAAGGTAGCAGG + Intergenic
1144097861 17:11918072-11918094 CTTTGAACATATCTGGTAGCAGG - Intronic
1150505858 17:65698527-65698549 CTTTGATGATCTAAGGAAGCCGG + Intronic
1154261434 18:12836605-12836627 CTTTGAGTATTTAAGATAAAAGG - Intronic
1154488489 18:14898928-14898950 TTTTAAGTAAATAATGTAGCTGG - Intergenic
1155278362 18:24211967-24211989 TTTTGAGGATATTAGGAAGCTGG + Intronic
1157887748 18:51384922-51384944 CTTTGAGTGGCTAAGGTAGGAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1161713202 19:5861568-5861590 CTTGGAGTTTCCAAGGTAGCAGG + Intergenic
930211357 2:48641606-48641628 CCTTGAGTATCTAAGGTATATGG + Intronic
933303749 2:80571897-80571919 CTTTGAATATATAACCTAGCAGG + Intronic
943722470 2:191219522-191219544 CATTAAGCATATAATGTAGCAGG + Intergenic
944564914 2:200980139-200980161 CTTGGAGTATGTAATGTATCAGG + Exonic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1173017447 20:39238396-39238418 CTTTGAGTATATATAGTAACTGG + Intergenic
1175491006 20:59381272-59381294 CTTTGAGTGGAAAGGGTAGCAGG + Intergenic
955057936 3:55472737-55472759 ATTTGAGAAGATAAGCTAGCTGG + Intronic
959308660 3:104701567-104701589 TTTTTAGTAAATAAGGTAGAGGG + Intergenic
960648308 3:119915439-119915461 CTTTGGGAATATAATGTAGTTGG - Intronic
960891762 3:122455850-122455872 CTTTGAAAATATAAAGTGGCCGG - Intronic
964733559 3:159892834-159892856 CTGTAAGTATATAAAGTACCTGG + Intronic
968885115 4:3324753-3324775 CTTTCAGCATCTTAGGTAGCTGG + Intronic
969778646 4:9379243-9379265 CTTTCAGTAGATAAGACAGCTGG - Intergenic
971030581 4:22633455-22633477 CCATGAGAATATAAGGTACCTGG - Intergenic
971128543 4:23780494-23780516 CTTTGAGTTTGTAAGGATGCTGG - Intronic
974555401 4:63440351-63440373 ATGTGAGCATATAAGGTAACAGG - Intergenic
975470693 4:74762708-74762730 CTCTCAGTATCTAAGGTAGATGG - Intronic
982781561 4:159496587-159496609 CTTTGGGTATATGAAGTAGGAGG - Intergenic
983153120 4:164310317-164310339 CTTTGGGAATACAAGGTAGGCGG - Intronic
983709975 4:170702370-170702392 CTTTGATTAGATAAGTGAGCTGG + Intergenic
984238449 4:177189663-177189685 CTTTTACTATATATGGTAGTTGG + Intergenic
986854040 5:11848549-11848571 CATTGTGTAAATAAGGTAGGGGG - Intronic
989443161 5:41495546-41495568 CTCTGAGAATATAAAATAGCAGG + Intronic
990408366 5:55514969-55514991 ATCTGTGTATATAAAGTAGCAGG - Intronic
992671791 5:79068990-79069012 CTTTGAGTACATATGGGAGTCGG - Intronic
994119947 5:96102257-96102279 CTTTCAGTGTAGAAGGGAGCAGG + Intergenic
994643150 5:102435508-102435530 CTTTGAGTATATAAGGTAGCAGG + Intronic
995102992 5:108338276-108338298 CTTTGAGAATATAAAGAAGAAGG - Intronic
998128521 5:139639525-139639547 CTGGGAGTATGGAAGGTAGCAGG - Intergenic
998429625 5:142059859-142059881 CTTAGAGTTAATAAGGTAGAAGG + Intergenic
1000678115 5:164148273-164148295 CATTAAGTATATAATGTAGATGG - Intergenic
1000939354 5:167341513-167341535 CTCTGAGTATTTCAGTTAGCTGG + Intronic
1002826181 6:776415-776437 CTTTGAGTGTATAAGGGACAGGG - Intergenic
1003808655 6:9754946-9754968 TTTTGAGTATATATGTTAGGGGG + Intronic
1010611625 6:77960682-77960704 TTTTGGGTATATACGGTAGTGGG + Intergenic
1012901992 6:105017289-105017311 GGTTGAGTATATGAGATAGCAGG + Intronic
1013986798 6:116203831-116203853 TATTGAGAATATAAGGTATCTGG - Intronic
1014424210 6:121284259-121284281 TTTTGTGTAGATAAGTTAGCTGG - Intronic
1015035573 6:128650221-128650243 CTTTGAGTATCTCAGGCAGCAGG - Intergenic
1015947563 6:138518570-138518592 CTTTAATTATATAGGCTAGCTGG - Intronic
1016222334 6:141690405-141690427 CATTAATTATATAAGGTACCTGG + Intergenic
1023113470 7:36837828-36837850 GTCTGAGTAGATAAGGGAGCAGG + Intergenic
1024683955 7:51724736-51724758 CTTTGAGTAGAGAAGATAACAGG - Intergenic
1026435995 7:70399231-70399253 CTTTGAGAAGCTAAGGTAGGAGG - Intronic
1039001229 8:32982315-32982337 CTTTGAGAAGATAAGGCAGGAGG + Intergenic
1047689004 8:127331488-127331510 CTTTGTGTTTATATGGTATCTGG - Intergenic
1048298219 8:133231698-133231720 ATTTCAGTATATAAAGTATCTGG - Intergenic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1061247097 9:129406133-129406155 CTTTCAGTAGAAAAGGGAGCAGG + Intergenic
1189449204 X:41111543-41111565 CTATGAGAAAATAGGGTAGCTGG + Intronic
1193932948 X:87579654-87579676 CTTTCAGGACATAAGGTAGTAGG + Intronic
1197328696 X:125126626-125126648 TTTAGAGCATATAAGGCAGCAGG - Intergenic
1197495852 X:127178875-127178897 TTTTAAGTATATATGATAGCCGG + Intergenic
1198823597 X:140675308-140675330 CTTTGAGTATATAGGATTGCTGG - Intergenic