ID: 994650313

View in Genome Browser
Species Human (GRCh38)
Location 5:102519268-102519290
Sequence CACAGAAGCCATTTTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994650313_994650316 10 Left 994650313 5:102519268-102519290 CCTAACCCAAAATGGCTTCTGTG No data
Right 994650316 5:102519301-102519323 TACCCAATCTCCTTTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994650313 Original CRISPR CACAGAAGCCATTTTGGGTT AGG (reversed) Intergenic