ID: 994651586

View in Genome Browser
Species Human (GRCh38)
Location 5:102535655-102535677
Sequence TTATCTTTCTTTGCATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994651584_994651586 3 Left 994651584 5:102535629-102535651 CCTAGAAGATAGAAACCATGCTT No data
Right 994651586 5:102535655-102535677 TTATCTTTCTTTGCATCTGCTGG No data
994651583_994651586 21 Left 994651583 5:102535611-102535633 CCAGAATATATATGAACTCCTAG No data
Right 994651586 5:102535655-102535677 TTATCTTTCTTTGCATCTGCTGG No data
994651582_994651586 22 Left 994651582 5:102535610-102535632 CCCAGAATATATATGAACTCCTA No data
Right 994651586 5:102535655-102535677 TTATCTTTCTTTGCATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994651586 Original CRISPR TTATCTTTCTTTGCATCTGC TGG Intergenic
No off target data available for this crispr