ID: 994653252

View in Genome Browser
Species Human (GRCh38)
Location 5:102556469-102556491
Sequence ATCCATCATTATAGGCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994653252_994653256 23 Left 994653252 5:102556469-102556491 CCTAGGTGCCTATAATGATGGAT No data
Right 994653256 5:102556515-102556537 ACACAACATGAAATATTATGTGG No data
994653252_994653255 -5 Left 994653252 5:102556469-102556491 CCTAGGTGCCTATAATGATGGAT No data
Right 994653255 5:102556487-102556509 TGGATTGGACAAAGAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994653252 Original CRISPR ATCCATCATTATAGGCACCT AGG (reversed) Intergenic
No off target data available for this crispr