ID: 994653255

View in Genome Browser
Species Human (GRCh38)
Location 5:102556487-102556509
Sequence TGGATTGGACAAAGAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994653252_994653255 -5 Left 994653252 5:102556469-102556491 CCTAGGTGCCTATAATGATGGAT No data
Right 994653255 5:102556487-102556509 TGGATTGGACAAAGAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994653255 Original CRISPR TGGATTGGACAAAGAAAATC TGG Intergenic
No off target data available for this crispr