ID: 994668910

View in Genome Browser
Species Human (GRCh38)
Location 5:102743175-102743197
Sequence CACAGTAAGCTAAAGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994668908_994668910 3 Left 994668908 5:102743149-102743171 CCAATAATTTTCTGAGAGAAGAG No data
Right 994668910 5:102743175-102743197 CACAGTAAGCTAAAGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994668910 Original CRISPR CACAGTAAGCTAAAGTGGTC TGG Intergenic
No off target data available for this crispr