ID: 994670269

View in Genome Browser
Species Human (GRCh38)
Location 5:102755164-102755186
Sequence GGGCGAGCGGCGGACCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 234}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994670258_994670269 11 Left 994670258 5:102755130-102755152 CCGGGGAGGGACTGAGACCTGCC 0: 1
1: 0
2: 3
3: 33
4: 407
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670252_994670269 24 Left 994670252 5:102755117-102755139 CCGGGAGCCGCCCCCGGGGAGGG 0: 1
1: 0
2: 12
3: 30
4: 315
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670257_994670269 12 Left 994670257 5:102755129-102755151 CCCGGGGAGGGACTGAGACCTGC 0: 1
1: 0
2: 3
3: 35
4: 332
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670263_994670269 -10 Left 994670263 5:102755151-102755173 CCCCAGGAGTCGAGGGCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670254_994670269 17 Left 994670254 5:102755124-102755146 CCGCCCCCGGGGAGGGACTGAGA 0: 1
1: 0
2: 0
3: 18
4: 251
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670255_994670269 14 Left 994670255 5:102755127-102755149 CCCCCGGGGAGGGACTGAGACCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670262_994670269 -6 Left 994670262 5:102755147-102755169 CCTGCCCCAGGAGTCGAGGGCGA 0: 1
1: 0
2: 1
3: 7
4: 97
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670250_994670269 25 Left 994670250 5:102755116-102755138 CCCGGGAGCCGCCCCCGGGGAGG 0: 1
1: 0
2: 3
3: 27
4: 332
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670256_994670269 13 Left 994670256 5:102755128-102755150 CCCCGGGGAGGGACTGAGACCTG 0: 1
1: 0
2: 1
3: 19
4: 247
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994670269 Original CRISPR GGGCGAGCGGCGGACCCGGC TGG Intronic
900192029 1:1355955-1355977 GGGGGAGGGGCGGACCCTGATGG + Intronic
900240761 1:1616205-1616227 GGGCCAGGGGCGGGCACGGCGGG - Intronic
900314644 1:2050700-2050722 GGGTGAGCGGCGGAGAGGGCGGG + Exonic
900349543 1:2228150-2228172 GGGCGGGCCGCGGAGCCGGCGGG + Intergenic
900406984 1:2497079-2497101 GGGCGAGCAGGGGACCCGCTGGG + Intronic
900629284 1:3625149-3625171 GGGCAGGCGGCGGCCCGGGCGGG + Exonic
901088356 1:6625484-6625506 GGGGCAGCGGCGCACCTGGCGGG + Intronic
901109855 1:6785690-6785712 GGGCGGGCGGGCGACCCGGCCGG + Intronic
901131340 1:6963694-6963716 GGGCGGGCTGCTGACCTGGCTGG + Intronic
901251542 1:7783797-7783819 GGGCGAGAGGCGGAGTCGGGGGG - Intergenic
903016793 1:20366702-20366724 GGGAGGGCGGGGGACCCAGCGGG - Intergenic
903115669 1:21176676-21176698 GGGGGGGGGCCGGACCCGGCGGG + Intronic
903258411 1:22117954-22117976 AGGGGAGCAGCGGACCCAGCTGG + Exonic
903603055 1:24556121-24556143 GGGAGCGCGGCGGTGCCGGCGGG + Exonic
903875906 1:26472824-26472846 GGAGGAGCGGCGGCCGCGGCGGG + Intronic
904215336 1:28914535-28914557 GGGCGGGCTGCGGGCCGGGCTGG + Intronic
906532828 1:46533232-46533254 GGGCGCTCGGCGGCCGCGGCGGG - Intergenic
906719754 1:47996756-47996778 CGGCGAGCAGCGGCCCCGCCAGG + Exonic
906960868 1:50418907-50418929 GGCCGAGCGGCGCGCCCAGCGGG + Exonic
907689120 1:56645183-56645205 GGGCGAGCGGCGGGCGGGGCGGG - Intronic
908977721 1:69919511-69919533 GTGCGAGCGGCGGACCCTGGCGG - Intronic
915517534 1:156421872-156421894 GGGGGAGGGGCGGGGCCGGCGGG - Intronic
915629231 1:157138653-157138675 GGCCCAGCAGCGGACCGGGCCGG - Intergenic
917565385 1:176207279-176207301 GCGCGAGCGGCGGAAGAGGCGGG + Exonic
923008005 1:230067381-230067403 GCGCGGGCGGCGGCGCCGGCAGG + Exonic
924289600 1:242524346-242524368 GGGCGAGCGGGAGGCCCAGCGGG + Exonic
924539847 1:244970621-244970643 GGCGGAGCGGCGGGCCGGGCGGG - Exonic
1065342834 10:24723217-24723239 GGCCGGGCGCCGGGCCCGGCCGG + Intronic
1065636781 10:27742681-27742703 GGGCCCGCGGCGAACCCGGAGGG - Intronic
1068335766 10:55630861-55630883 GGGCGCGGGGCTGACCCTGCGGG - Intergenic
1069438552 10:68407340-68407362 GGGGGAGCGGCGCCCCGGGCGGG + Intergenic
1069711185 10:70489555-70489577 GGGGGAGGGGAGGACCTGGCAGG + Intronic
1069920583 10:71813182-71813204 GGGCGAGGGGCGGGGCAGGCAGG + Intronic
1070032786 10:72692796-72692818 GGACGAGGGGCGGCCCCGCCGGG - Intronic
1070800824 10:79243533-79243555 GAGCGGGCGCCGGACCCGCCCGG + Intronic
1071477795 10:86039635-86039657 GGGCGAGCTGAGGCCCAGGCTGG + Intronic
1072745248 10:97934969-97934991 GGGGGAGCGGCGGGCGCGGCGGG + Intronic
1073101070 10:101006949-101006971 GGGGGAGCGGCTGGCCTGGCAGG + Exonic
1073305820 10:102502683-102502705 GCGCTAGCGGCGGACCCGGCTGG - Exonic
1075866019 10:125719844-125719866 CCTCGAGCGGCGGCCCCGGCCGG - Exonic
1076638974 10:131901190-131901212 GGGCGGGCGGGGGCCGCGGCCGG + Intronic
1076885142 10:133258753-133258775 GGGGAAGCGGCGGACCCTGGGGG + Intergenic
1077048478 11:556209-556231 GGGCCAGCAGCGTGCCCGGCGGG + Exonic
1077160486 11:1110312-1110334 AGGGGAGCGCCGGGCCCGGCGGG - Intergenic
1077250056 11:1556996-1557018 GAGCGCGCGGGGGAGCCGGCGGG + Exonic
1077419936 11:2445297-2445319 GGGGGCGCGGCGGGCGCGGCCGG - Exonic
1077917918 11:6622999-6623021 GGGTGGGGGCCGGACCCGGCGGG - Exonic
1083667892 11:64285405-64285427 GGGCGAGGGGCGGGCCCGCGCGG + Intronic
1084151338 11:67289279-67289301 GGGCGGGCGGCGGAGCGGGCGGG - Exonic
1085027028 11:73242418-73242440 GGGCGAGGGGCAGTCCTGGCAGG + Intergenic
1087505914 11:99020856-99020878 GGGCGAGGGGCCGCCCCGGGAGG + Intergenic
1089525590 11:119094714-119094736 GGGCGGACGGCGGACAGGGCAGG + Exonic
1090636373 11:128692874-128692896 GGGCGCGCGGCGGCCCAGGAGGG + Intronic
1094466082 12:30754925-30754947 GCGCGAGCGGCTGAGTCGGCTGG - Intronic
1096241285 12:49961665-49961687 GGGCCGGCGGCTGCCCCGGCCGG + Intergenic
1096699264 12:53371513-53371535 GGGCGGGCGGAGGGCCGGGCTGG - Intergenic
1096846748 12:54411738-54411760 GGGCGAGGGGTGGAGCCTGCTGG - Intronic
1103381266 12:120496039-120496061 CGGCGAGGGGCGGGGCCGGCGGG + Intronic
1103527832 12:121579487-121579509 GGGCGGGCGGCGGGGGCGGCTGG - Intronic
1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG + Intronic
1103563493 12:121804325-121804347 GGGCGGGCGGCGGCGCCGCCAGG + Intronic
1104961519 12:132490420-132490442 CGGCGGGCGGCGGGCCGGGCCGG - Exonic
1106308345 13:28532653-28532675 GGGCGCGCGGCGCCCCCGGCCGG - Intergenic
1106517124 13:30465283-30465305 GGGCGGGCGGCGGGGCGGGCGGG - Intronic
1106956321 13:34942645-34942667 GGGAGAGCGCCGGAGCGGGCCGG + Exonic
1108518309 13:51222688-51222710 GAGAGAGCGGGGGATCCGGCAGG - Intronic
1110436185 13:75481052-75481074 GGGCGAGCGGCGGGAGCGGCCGG - Intronic
1112344369 13:98577324-98577346 GGGCGGGCGGCGGGGCCGGGAGG + Intronic
1112402012 13:99086107-99086129 GGCAGAGCGGCCGACCCTGCTGG - Intronic
1113614020 13:111668701-111668723 GGGGGAGCCGCGGGCCCTGCGGG - Intronic
1113949976 13:114066415-114066437 GGGCGAGAGGAGGCCCGGGCAGG + Intronic
1119046322 14:71321125-71321147 GAGCGCGCGGCGGACGCGCCCGG + Intronic
1120881321 14:89417108-89417130 GGGAGAGCGGCGGGGCCGGCGGG - Intronic
1122267256 14:100552510-100552532 GGGAGGGCGGCAGCCCCGGCAGG - Intronic
1122270906 14:100568149-100568171 GGGAGCGCGGCGGCCCGGGCGGG - Intronic
1122444953 14:101761592-101761614 GGGCGAGCGGCGGGCGGGGCGGG + Intergenic
1122545024 14:102517273-102517295 GGCCGATCGGAGGTCCCGGCGGG + Intergenic
1122905676 14:104800524-104800546 GGGCGAGCGGCGGGCGGCGCTGG + Intergenic
1122947773 14:105021015-105021037 GGCTGAGCAGAGGACCCGGCGGG - Exonic
1124640154 15:31391994-31392016 GGGCGGGCGCCGAGCCCGGCCGG + Intronic
1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1129162161 15:73752977-73752999 GGGCGAGCGGCGGGCCGGGCCGG + Intergenic
1129410794 15:75349217-75349239 GGGCGAGCCGGGGGCCAGGCGGG - Exonic
1129823702 15:78620806-78620828 GGGCTGGCCGCGGACCCGGACGG + Exonic
1132883789 16:2173595-2173617 GGGAGGCCGGCGGCCCCGGCAGG + Intronic
1132947198 16:2538177-2538199 GGGCGGCCGCCGGACCCGGCAGG - Intronic
1133188426 16:4116279-4116301 GGGCGGGCGGGCGTCCCGGCCGG - Intergenic
1133784402 16:8963523-8963545 GGGCGGCCGGCGGGCCGGGCCGG + Intronic
1133784501 16:8963753-8963775 GCGGGAGCGGCGGAGCGGGCGGG + Intronic
1136156070 16:28383118-28383140 GGGCGAGCGACAGCCCCTGCTGG - Exonic
1136207016 16:28732170-28732192 GGGCGAGCGACAGCCCCTGCTGG + Exonic
1136247793 16:28985321-28985343 GGGTGAGGACCGGACCCGGCAGG - Intronic
1136544726 16:30948694-30948716 GGGCAAGCGGGGGACCCAGCCGG + Exonic
1136588480 16:31202704-31202726 GGGTGAGCGGCGGCAGCGGCCGG - Exonic
1137621039 16:49876720-49876742 GGGCGAGGGGCGGGAACGGCTGG + Intergenic
1138428362 16:56951422-56951444 GGGTGAGCGGTGGCCCTGGCTGG + Intergenic
1139402941 16:66696653-66696675 GGGCGAGAGGCGGCGGCGGCGGG - Exonic
1140209414 16:72958986-72959008 GGGCCAGCGGCGGAGCCCGCTGG + Exonic
1141184698 16:81779178-81779200 CTCCGAGAGGCGGACCCGGCTGG + Intronic
1141608665 16:85169487-85169509 GGGCGCGCGGGGGCCCGGGCGGG + Intergenic
1142495603 17:304959-304981 GGGCGAGAGGGGGACAGGGCGGG + Intronic
1142495622 17:305006-305028 GGGCGAGAGGGGGACAGGGCGGG + Intronic
1142495642 17:305054-305076 GGGCGAGAGGGGGACAGGGCGGG + Intronic
1143562759 17:7705300-7705322 GGGGGAGCCGGGGACCGGGCGGG - Exonic
1144828800 17:18120822-18120844 GGGAGAGCGGCGGCGCGGGCGGG - Exonic
1144840717 17:18184103-18184125 GCGTGAGTGGGGGACCCGGCGGG - Intronic
1146009180 17:29180204-29180226 GGGCGGGCGGCGGGGCCCGCCGG - Intronic
1146057694 17:29589423-29589445 GCGCGGGCGGCGGGCCCGGGCGG + Exonic
1146219868 17:31008808-31008830 GGGGGAGCGCCGGGCCGGGCTGG + Intergenic
1146255991 17:31391796-31391818 GGGCAGGCGGCGGGCGCGGCGGG + Exonic
1147006312 17:37406817-37406839 GGCCGAGGGGCGGAGGCGGCGGG + Intronic
1148697506 17:49570108-49570130 GAGCGCGCGGCGGGCGCGGCGGG + Intergenic
1148786837 17:50149733-50149755 GGGCGGGCGGCGGCGGCGGCGGG + Exonic
1150373470 17:64661802-64661824 GGGGGGGCGGCGGGCCGGGCTGG - Intronic
1150778750 17:68101965-68101987 GGGGGCGCGGCGGGCCGGGCTGG + Intergenic
1150790603 17:68198182-68198204 GGGGGCGGGGCGGGCCCGGCTGG + Intergenic
1151875959 17:76868481-76868503 GCGCGGGCGGCGGAGCCAGCGGG + Intronic
1152349792 17:79778170-79778192 GGGCGCGCGGCGGTCCGGGCGGG + Exonic
1152349820 17:79778318-79778340 CGGCGGGCGGGGGGCCCGGCGGG - Intronic
1152362539 17:79839348-79839370 GGGCGAGCGGCGGCGGCGGCGGG - Exonic
1152719755 17:81917758-81917780 GGGCGACGGGCGGTCCCGGGTGG - Intronic
1152751762 17:82065624-82065646 AGGCGCGCGGCGGACACGGCGGG - Intronic
1156099733 18:33578719-33578741 GGGCGAGCGGCGGGGCCGGCGGG - Intronic
1157545160 18:48541226-48541248 GGGCGGGCGGCGGCCTGGGCCGG - Intronic
1158579860 18:58671691-58671713 GGGCGAGCAGCGGCCCCGTGGGG - Exonic
1160024116 18:75204761-75204783 GGTCGGGCGGGGGCCCCGGCAGG + Intronic
1160766880 19:812716-812738 GGGCGAGGGGCTGCCCCCGCTGG - Exonic
1160903010 19:1438563-1438585 GGGCGAGGGGCGGACTTGGTGGG + Intronic
1160967910 19:1754561-1754583 GGGGAGGCGGCGGCCCCGGCGGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1162722376 19:12670096-12670118 GGGTGAGCCGGGGACCAGGCTGG + Exonic
1163398088 19:17075762-17075784 GGGGGAGCGGCGGGCGCGGCGGG + Exonic
1163551149 19:17967096-17967118 GGGCGAGCGCCCGCCCGGGCCGG - Intronic
1163729561 19:18941245-18941267 GGGCGGGCGGCGGCCGCGTCGGG - Intronic
1163748967 19:19064145-19064167 GGGCGAGGGGCGGATGAGGCGGG + Intronic
1165787841 19:38473199-38473221 GGCCCAGCGGTGTACCCGGCCGG + Intronic
1165900434 19:39167060-39167082 GGGCGGGCGGCTGGCCCAGCTGG - Intronic
1165940701 19:39413495-39413517 GGGCGAGCCGAGGCGCCGGCGGG + Intronic
925959717 2:9003632-9003654 GGGCGAGCGGCGCGGGCGGCCGG - Exonic
927881509 2:26692850-26692872 GGGCCGGCGGCGGCCCGGGCGGG + Exonic
928186618 2:29115864-29115886 GGCGGAGCGGCCCACCCGGCGGG + Intronic
929107122 2:38376738-38376760 CGGCGAGCTCCGGACGCGGCGGG - Intronic
929604175 2:43224530-43224552 GGAGGTGCGGCGGCCCCGGCGGG + Exonic
931763699 2:65436595-65436617 GGGCGTGCGGCGGCCCAGTCGGG + Intergenic
932763749 2:74457567-74457589 GGGCGAGCGGCGGGGAGGGCGGG + Exonic
933655259 2:84881274-84881296 AGGTGGGCGGCGGCCCCGGCAGG - Intronic
935112456 2:100105237-100105259 CCGCGGGCGGCGGACCCGGGTGG + Intronic
937221736 2:120346050-120346072 GGGCGGGCGGAGGCCCGGGCGGG + Intergenic
937368859 2:121284545-121284567 GGGCGGGCGGCGGGCTCGGAGGG - Intronic
938073188 2:128318916-128318938 GGGCCAGGGGCGGACCGGGGCGG - Intergenic
940317070 2:152336484-152336506 GAGGGAGCGGGGGACCTGGCTGG - Intronic
940517421 2:154698634-154698656 GGGTGGGGGGCGCACCCGGCAGG - Exonic
946019876 2:216633688-216633710 CGGCGGGCGGCGCAACCGGCGGG - Exonic
946395459 2:219441950-219441972 GGGCGAGCTGGGGAGCGGGCGGG - Intronic
946405613 2:219490493-219490515 GGGCAAGCGGCGGGTCCTGCAGG + Exonic
948645177 2:239400319-239400341 GGGCGGGCGCCGGGGCCGGCCGG - Intronic
948811571 2:240481037-240481059 GGGCAAGAGGCGGACCCCGATGG + Exonic
948874668 2:240820252-240820274 GGGCGCGGGGCGGTCCGGGCCGG - Exonic
949014586 2:241702202-241702224 GGGAGGGCGGCGGGCGCGGCCGG + Intronic
1169044415 20:2524632-2524654 GGGAGAGCTGCGGGCCCCGCCGG + Intronic
1169227581 20:3865974-3865996 GGGCCACCTGCGGACCCGGATGG + Exonic
1170756899 20:19212812-19212834 GGCCGGGCGGCGGCCTCGGCGGG - Exonic
1173413875 20:42838832-42838854 GGATGAGCGGGGGACACGGCTGG - Intronic
1173633235 20:44532045-44532067 GGGCGAGGGGCTGAGCCGCCGGG + Intronic
1173649091 20:44651692-44651714 GGGCCAGCGGTGGCCGCGGCCGG + Exonic
1173727659 20:45308462-45308484 GGGCTAGCTGCGGGCCAGGCTGG + Intronic
1174357859 20:50010206-50010228 GGGCGCGCGGTGGTCCCGGGAGG - Intergenic
1175399578 20:58692844-58692866 GGCCGAGCGGCGGGCCGGGCCGG + Exonic
1175901489 20:62361584-62361606 GGGGCAGCGGCGGAGCCGGCTGG + Intronic
1176162166 20:63653465-63653487 GGGCGGGAGGCGGGCGCGGCGGG + Intergenic
1176550500 21:8218959-8218981 GTGCGTGCGGGGGGCCCGGCGGG + Intergenic
1176569430 21:8401998-8402020 GCGCGTGCGGGGGGCCCGGCGGG + Intergenic
1176577342 21:8446229-8446251 GTGCGTGCGGGGGGCCCGGCGGG + Intergenic
1179605794 21:42514339-42514361 GGGTGGGCAGGGGACCCGGCTGG - Exonic
1179675072 21:42975206-42975228 GGGCGCGCGGCGGCGCAGGCGGG + Intronic
1180005394 21:45018448-45018470 GGGCCAGAGGCGGTCGCGGCGGG + Intergenic
1180130291 21:45822658-45822680 GAGTGAGGGGCGGACCCAGCAGG + Intronic
1181265830 22:21630017-21630039 GCGCGAGCGGTGGACCCAGGCGG - Exonic
1182475505 22:30574550-30574572 GGTGGAGCGGGGGGCCCGGCCGG - Intronic
1182664134 22:31944914-31944936 GGGCGACCCGGCGACCCGGCTGG + Intronic
1183586402 22:38755601-38755623 GCGCGGGCCGCGGACCCGGGTGG + Intronic
1183645705 22:39124771-39124793 GGGCGTGGGGGGGACACGGCGGG + Intronic
1184337420 22:43862071-43862093 GGGAGAGCGGTGGGCACGGCAGG + Intronic
1203255397 22_KI270733v1_random:135300-135322 GTGCGTGCGGGGGGCCCGGCGGG + Intergenic
950632630 3:14293303-14293325 GGCCGGCCGGCGGACCCCGCGGG + Intergenic
952644460 3:35639234-35639256 GGGCGCCCGGCGCACCCAGCAGG + Intronic
952889138 3:38029468-38029490 GCGCGAGCGGGAGACCCTGCAGG - Intronic
953385282 3:42502667-42502689 TGGCGGGCGGCGCACCAGGCGGG - Exonic
953385303 3:42502741-42502763 GGGCGGGCAGCGGACTTGGCGGG - Exonic
954304483 3:49718206-49718228 GGGCCAGCGGCGGCAGCGGCAGG + Exonic
956678185 3:71754287-71754309 CGGCGTGCGGCGGCCGCGGCGGG + Exonic
960664267 3:120094588-120094610 GGGCGAGCGTGGGGCTCGGCCGG - Intergenic
965648362 3:170908392-170908414 AGGCGAGCGCGGGACCCGCCGGG - Intronic
968178115 3:196568811-196568833 GGGCGCGCGGCGGACGCCCCCGG + Exonic
968636681 4:1684484-1684506 GGGCGCGCTGCGGACTCGGTGGG - Intergenic
968701281 4:2059347-2059369 GGGCGCGGGGCGGAGGCGGCGGG - Intergenic
968729329 4:2262201-2262223 GGGCGGGCGCCGGGCCGGGCTGG + Exonic
968729422 4:2262604-2262626 GGGCGTGCGCCGGGCCGGGCCGG + Intergenic
968741636 4:2334408-2334430 GGGCCAGCGGCGGGGCCTGCAGG - Intronic
971244004 4:24912651-24912673 GGAGGAGCGGCGCACCTGGCGGG + Intronic
971244140 4:24913110-24913132 GGGCGCGGGGCGGGCCCGGCGGG - Intronic
973954452 4:56049235-56049257 CGGCGACCGGCGGTCCCGGGCGG - Intergenic
976246736 4:83012618-83012640 AGGGGCGCGGCGGACCCCGCTGG + Intronic
978490003 4:109302394-109302416 GGGCGAGCCGCGGCCCCGCGTGG - Exonic
979523828 4:121697076-121697098 GGGGCAGGGGCGGGCCCGGCTGG - Exonic
984778664 4:183505120-183505142 GGGCCCGCGGCGGCCGCGGCCGG + Exonic
992939512 5:81750032-81750054 GCGGGAGGGGCGGGCCCGGCGGG - Intronic
994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG + Intronic
996291005 5:121852135-121852157 GGGCCGGCGGCGGGCCCGGTAGG - Exonic
997201363 5:132011789-132011811 GGGCAAGCCCCAGACCCGGCCGG - Intronic
998478370 5:142440682-142440704 GTGCTAGCGGCAGACCCGTCAGG - Intergenic
1002074600 5:176700603-176700625 GAGCGAGAGGAGGAGCCGGCAGG + Intergenic
1002204703 5:177554417-177554439 GGCCGAGCGGCGGTGCGGGCAGG - Exonic
1002405034 5:179023933-179023955 GGGCGTGCGGCTGCCGCGGCGGG + Intronic
1003531360 6:6940185-6940207 GAGCGGCCGGCCGACCCGGCCGG + Intergenic
1004217052 6:13712197-13712219 GGGCTCGCGGCGGCCCCAGCGGG - Intergenic
1004519301 6:16346973-16346995 GGAGCAGCGGCGGACCCCGCCGG + Intronic
1005987756 6:30884765-30884787 GGGCGCGCGGCGGCGCCTGCAGG + Intronic
1006170128 6:32087631-32087653 GGGGGTGCGGGGGAGCCGGCTGG + Intronic
1007473295 6:42104442-42104464 AGGTGAGCTGCGGGCCCGGCTGG - Exonic
1008160393 6:48068874-48068896 GGGCGGGCGGCGGGCGCCGCGGG + Intergenic
1008378695 6:50819899-50819921 GGGCGCGCGGCGGGCCAGGCTGG + Intronic
1010204491 6:73310201-73310223 GAGCGAGCGGCGGAAGAGGCGGG - Exonic
1010791564 6:80070643-80070665 GGCCGGGCGCCGGGCCCGGCCGG + Intergenic
1013576022 6:111483743-111483765 GGGCGGGCGGCGGAACGGGCGGG + Intergenic
1018652893 6:166006129-166006151 GGGCGGGCGGGGGGCCCGGGGGG - Intergenic
1018686335 6:166307519-166307541 AGGCGCGCGGCGGCCCTGGCCGG + Exonic
1019350707 7:552697-552719 AGGCGAGCGGAGGAGCCGGGAGG + Intronic
1019693950 7:2434117-2434139 GGGCGAGCGGGCGAGCGGGCGGG - Exonic
1022163961 7:27740068-27740090 AGGGGAGCGGCGAACCAGGCAGG + Intronic
1023202121 7:37709948-37709970 GGGCGTGCAGGGAACCCGGCAGG - Intronic
1023722914 7:43113557-43113579 GGCTGAGCGGCGCAGCCGGCCGG - Intronic
1023832017 7:44044880-44044902 GGGCGAGCGGGGGACTCGGGGGG + Intronic
1023991602 7:45132090-45132112 GGGCGTGCTCCGGACCAGGCAGG - Intergenic
1028160166 7:87475889-87475911 GGGTGGGCGGCGGCCCCAGCCGG - Intronic
1029423528 7:100483745-100483767 GGGGGAGCCGCGGAGCCTGCGGG - Intergenic
1035160934 7:156949644-156949666 GGGCGGGCGGCGCCCCCTGCTGG - Intergenic
1037957109 8:23068669-23068691 GGGAGAGAGGGGGACACGGCGGG - Intronic
1038041447 8:23727128-23727150 GGGCGGGCGGCGGCCCCGGGCGG + Intergenic
1038542702 8:28402469-28402491 GGGAGAGCGGCGCCCCAGGCGGG - Intronic
1039212811 8:35235788-35235810 GGGAGAGCGGCGGCCACCGCAGG + Exonic
1044698858 8:94949047-94949069 GGGCGCGCGGCCGGCCCCGCCGG + Intronic
1045111552 8:98942072-98942094 GGGCGGGCGGCGAGCCTGGCGGG + Intronic
1046636512 8:116679358-116679380 GGGCGGGGGGCTGACCGGGCGGG - Intronic
1048214077 8:132480283-132480305 GGGGCAGCGGAGGACCCCGCAGG - Exonic
1049212196 8:141391971-141391993 GGGCGCGCGCCGGACCCGCTGGG - Intronic
1049585397 8:143430490-143430512 CCGCGGGCGGCGGTCCCGGCGGG + Intergenic
1053003508 9:34590432-34590454 AGGGGAGAGGCGGAGCCGGCTGG - Intergenic
1053114761 9:35490634-35490656 GAGGGAGCAGAGGACCCGGCCGG - Intronic
1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1057259560 9:93576347-93576369 GCGGGAGCGGCGGCCCAGGCCGG + Intergenic
1059102499 9:111483926-111483948 GGGCGCGCGAGGGGCCCGGCGGG - Intronic
1060183553 9:121550570-121550592 GGGAGAGCGGAGGACACCGCGGG - Intergenic
1060811789 9:126614419-126614441 GGGCGCGCTGCGGACCCCGCCGG - Intergenic
1060812079 9:126615628-126615650 GGGCGCGGGCCGGGCCCGGCAGG - Intronic
1061490145 9:130939924-130939946 GGGCGGCCGGCGGGCTCGGCGGG - Intergenic
1061540817 9:131277211-131277233 GGGCGAGCGGCTGCCGCTGCAGG + Intergenic
1061613285 9:131762704-131762726 GAGCCAGCGGCGGACCTCGCTGG + Intergenic
1061802669 9:133120877-133120899 GGGCGAGCCCCGGACGGGGCCGG - Intronic
1062022741 9:134326872-134326894 GGGCGGGCGGCGGGGCCGGGGGG + Intronic
1062292747 9:135804549-135804571 GGGCGAGGTGTGGACCCAGCTGG - Intergenic
1062341190 9:136094683-136094705 GGGCGAGGCGCGGGCCCGGCTGG + Intronic
1203471795 Un_GL000220v1:118435-118457 GCGCGTGCGGGGGGCCCGGCGGG + Intergenic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic