ID: 994670269

View in Genome Browser
Species Human (GRCh38)
Location 5:102755164-102755186
Sequence GGGCGAGCGGCGGACCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 234}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994670250_994670269 25 Left 994670250 5:102755116-102755138 CCCGGGAGCCGCCCCCGGGGAGG 0: 1
1: 0
2: 3
3: 27
4: 332
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670262_994670269 -6 Left 994670262 5:102755147-102755169 CCTGCCCCAGGAGTCGAGGGCGA 0: 1
1: 0
2: 1
3: 7
4: 97
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670256_994670269 13 Left 994670256 5:102755128-102755150 CCCCGGGGAGGGACTGAGACCTG 0: 1
1: 0
2: 1
3: 19
4: 247
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670258_994670269 11 Left 994670258 5:102755130-102755152 CCGGGGAGGGACTGAGACCTGCC 0: 1
1: 0
2: 3
3: 33
4: 407
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670263_994670269 -10 Left 994670263 5:102755151-102755173 CCCCAGGAGTCGAGGGCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670254_994670269 17 Left 994670254 5:102755124-102755146 CCGCCCCCGGGGAGGGACTGAGA 0: 1
1: 0
2: 0
3: 18
4: 251
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670255_994670269 14 Left 994670255 5:102755127-102755149 CCCCCGGGGAGGGACTGAGACCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670252_994670269 24 Left 994670252 5:102755117-102755139 CCGGGAGCCGCCCCCGGGGAGGG 0: 1
1: 0
2: 12
3: 30
4: 315
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234
994670257_994670269 12 Left 994670257 5:102755129-102755151 CCCGGGGAGGGACTGAGACCTGC 0: 1
1: 0
2: 3
3: 35
4: 332
Right 994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994670269 Original CRISPR GGGCGAGCGGCGGACCCGGC TGG Intronic