ID: 994672861

View in Genome Browser
Species Human (GRCh38)
Location 5:102783712-102783734
Sequence ATGTGCATGCAGCAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994672853_994672861 24 Left 994672853 5:102783665-102783687 CCTCTGTGCCAGTTTGCATACTG 0: 1
1: 0
2: 2
3: 14
4: 182
Right 994672861 5:102783712-102783734 ATGTGCATGCAGCAGTATGAGGG 0: 1
1: 0
2: 0
3: 12
4: 142
994672855_994672861 16 Left 994672855 5:102783673-102783695 CCAGTTTGCATACTGGAATGTCT 0: 1
1: 0
2: 1
3: 11
4: 119
Right 994672861 5:102783712-102783734 ATGTGCATGCAGCAGTATGAGGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994672861 Original CRISPR ATGTGCATGCAGCAGTATGA GGG Intronic
900556293 1:3282519-3282541 GTGTGCATGGAGCAGCATCAGGG - Intronic
900876937 1:5349543-5349565 ATGTGCAAGAAGCAGGATGAGGG + Intergenic
902675801 1:18007844-18007866 ATGTGCCGGCAGCTGTCTGATGG + Intergenic
903975650 1:27148269-27148291 ATTTGCATGAAGGAGGATGAGGG - Intronic
905269268 1:36776398-36776420 ATGTGCATGCAGGAAAATGTGGG + Intergenic
905604486 1:39285658-39285680 ATGTACATTCAGGAGTGTGAAGG + Exonic
906033924 1:42739398-42739420 ATGTGCATGCACCCATATGCTGG + Intronic
911878729 1:103204873-103204895 TTGTGGATGGAGCAGAATGAGGG - Intergenic
912699176 1:111863794-111863816 AGGTGAATGCAGCAGGATGCAGG + Intronic
921816219 1:219567003-219567025 AGGTGCATGCAACAGTATTGAGG + Intergenic
922060160 1:222081597-222081619 ATATGCAAGCAGCTGTATCAAGG - Intergenic
1063033219 10:2256959-2256981 ATGAGCAGGCAGCAGTAGAAAGG - Intergenic
1063594447 10:7421127-7421149 ATGTGCATCCAGCAGAACCATGG - Intergenic
1066246765 10:33591475-33591497 CTGGGCATGCAGGAGTCTGATGG - Intergenic
1066302455 10:34108855-34108877 ATATGCATGCGGCATTTTGAAGG - Intergenic
1066511696 10:36106245-36106267 ATGTTCATTCAAGAGTATGAGGG + Intergenic
1066708986 10:38212822-38212844 ATGTGTATGCAGCAATATTGGGG - Intergenic
1068045565 10:51881946-51881968 ATGGTCATGCAGCAGCATGGTGG - Intronic
1068817635 10:61335550-61335572 ATATGCATGCAGAAGTATCAGGG - Intergenic
1069338105 10:67377269-67377291 ATGTGTATGTAGCAGCATCAGGG + Intronic
1069583409 10:69580192-69580214 ATGTTCATGCAGAATTTTGAAGG + Intergenic
1071494709 10:86160260-86160282 AGGTGCATGCAGCAGGAGGGAGG - Intronic
1072377780 10:94835718-94835740 ATGTCCATGAAGCAATATGGAGG - Intronic
1072868056 10:99085540-99085562 AAGTTTATGAAGCAGTATGATGG - Intronic
1074183383 10:111082037-111082059 CTGTGTATGCAGCAGTGGGAGGG + Intergenic
1075141511 10:119841514-119841536 AAGTTCATGAAGCATTATGATGG + Intronic
1075776750 10:124994096-124994118 ATGTGTGTGCTGCAGTTTGAGGG + Intronic
1075953054 10:126498567-126498589 ATGGCCATTCAGCAGTGTGATGG + Intronic
1080679549 11:34461368-34461390 ATGTGCATGCAGGACAATCAGGG + Exonic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1086178194 11:83917953-83917975 AAGTGCATGAAGAAGAATGAAGG + Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087765441 11:102147385-102147407 ATGTACATGCGGGAGTTTGAGGG + Intronic
1090207687 11:124895035-124895057 ATGTCCTGGCAGCAGTAGGAAGG + Intronic
1090248429 11:125234464-125234486 ATGTGCATAGAGAAGAATGATGG - Intronic
1091229345 11:133977641-133977663 ATGTGAATGCAGCATTAGGCTGG - Intergenic
1092122224 12:6052518-6052540 AAGTGCAGGCAGCAGTGTCAGGG - Intronic
1093514448 12:19969609-19969631 ATGTGCATGCAGCCCTAAGTAGG - Intergenic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1112654250 13:101432947-101432969 AAGTGCATCCAGCAGTCTCAAGG + Intergenic
1113135148 13:107080744-107080766 GTGTGGCTGCAGCAGCATGAGGG - Intergenic
1114486509 14:23065755-23065777 ATGTGACTGGAGCAATATGATGG + Intronic
1116435332 14:44889401-44889423 ATGAGCAGGCAGCAGGCTGAGGG - Intergenic
1119438345 14:74612191-74612213 CTGTGCCTGCAGCCGTCTGAAGG + Exonic
1121662337 14:95644655-95644677 AAGTGGATTCAGCAGGATGATGG + Intergenic
1121962999 14:98278391-98278413 AAGTGCATGAAGCTGTGTGAGGG - Intergenic
1123183072 14:106487977-106487999 ATGAGCATGCACCACCATGAAGG + Intergenic
1129758078 15:78110555-78110577 AAGTGCATTCAGCATTAAGAAGG - Intronic
1131349067 15:91679904-91679926 ATGTGCATGCTGGAGTTTGGAGG - Intergenic
1132328403 15:100992395-100992417 ATGTCAATGCAACATTATGATGG - Intronic
1138334080 16:56238534-56238556 ATGTTCTTGCAGCAGTGGGATGG - Intronic
1138939976 16:61778329-61778351 ATGTGCCTGCTTCATTATGAGGG + Intronic
1141648148 16:85378290-85378312 ATGGGCAGGCAGCAGCATGGAGG - Intergenic
1144095274 17:11894684-11894706 AGGTGCATGCTGGTGTATGAGGG + Intronic
1147124094 17:38353450-38353472 ATTTGCATGCATGAGTGTGAAGG - Intronic
1149414229 17:56442194-56442216 ATGTGTATGCAGCTGAATGAAGG + Intronic
1153747563 18:8195578-8195600 ATGTCTTTGCAGCAGCATGAAGG + Intronic
1153788410 18:8555483-8555505 GTGTGCATAAAGCAGGATGAGGG - Intergenic
1156884752 18:42122220-42122242 ATTTTCATGCAGCAGTAACAAGG - Intergenic
1157217835 18:45800521-45800543 ATGGGCATGCAGCACCATGATGG + Intergenic
1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG + Intergenic
1159379781 18:67641834-67641856 CGGTGCATGCAGCAATAAGAAGG + Intergenic
1160288847 18:77572023-77572045 ATGTGCATGTAGAAGGATGGAGG + Intergenic
1166640447 19:44490324-44490346 ATGTTCATGCAGCAATTTCAAGG - Intronic
925452672 2:3983327-3983349 ATTTGCATGCAGAAGTATTCAGG + Intergenic
925917173 2:8615084-8615106 ACGTGCATGAAGCAGCATCAGGG + Intergenic
926926688 2:17994911-17994933 ATGTGCCTGCAGCAGACTAAGGG + Intronic
930105486 2:47635809-47635831 GGGTTCATGCAGCAGGATGATGG - Intergenic
930851053 2:55960801-55960823 ATGTGCATGCATCTGTGTGTAGG - Intergenic
934883200 2:98001301-98001323 AAGTTCATGCAGCAGGATGAGGG + Intergenic
936145145 2:109975859-109975881 ATGTGCACCCAGCAGTGTCATGG + Intergenic
936199540 2:110395619-110395641 ATGTGCACCCAGCAGTGTCATGG - Intergenic
936540692 2:113348428-113348450 ATGTACATGAATCAGGATGATGG - Intergenic
940219710 2:151339157-151339179 ATGTGAATGCAGCAGATTGTTGG + Intergenic
940949775 2:159660397-159660419 ATGTTCATGCAGCATCATAATGG - Intergenic
943772958 2:191738853-191738875 ATGTGCATGCTGCTGTATCTAGG - Intergenic
944325017 2:198394235-198394257 ATGTGCATACAACAATATGATGG + Intronic
944482194 2:200169189-200169211 ATGTGCATGCTGTAGTATTTGGG - Intergenic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
949081149 2:242100663-242100685 ATGTGTATGGTGCAGTAGGAGGG + Intergenic
1170779499 20:19411513-19411535 AAGTGCATCCAGCAGCAAGAAGG + Intronic
1170838760 20:19907096-19907118 ATGTGCATGCAAGGGTAGGAGGG + Intronic
1172817249 20:37697380-37697402 ATGTGAAGGGAGCAGAATGATGG + Intronic
1173104480 20:40120296-40120318 CTGTGCATGCAGTAGTAGAAGGG - Intergenic
1176288030 21:5029104-5029126 AGCTGCATGCAGCGGGATGAGGG + Intronic
1178003684 21:28192840-28192862 CTGTGTCTGCAGCAGTGTGAGGG - Intergenic
1179777980 21:43680012-43680034 ATTTACATGAATCAGTATGATGG - Intronic
1179869151 21:44234371-44234393 AGCTGCATGCAGCGGGATGAGGG - Intronic
1182143470 22:27982399-27982421 CTGTCCCTGCAGCAGCATGACGG - Exonic
1182777453 22:32841359-32841381 ATGTGCATGGATCAGGATCAGGG + Intronic
1184201588 22:42973076-42973098 ATGTGTTTGCTGCAGTATGTGGG - Intronic
949356365 3:3184220-3184242 AGGTGCTTGCAGCACTGTGATGG + Intergenic
949867695 3:8560041-8560063 ATATTCTCGCAGCAGTATGAAGG - Intronic
965670541 3:171143292-171143314 CTGTGCATGGAGCCGTATGAGGG + Intronic
966005404 3:175005374-175005396 AAGTGTAGTCAGCAGTATGAAGG - Intronic
966176766 3:177146910-177146932 TTGTGAATGCAAAAGTATGATGG - Intronic
966476684 3:180356686-180356708 ATGTGCAGGCAGTGGTATGTTGG - Intergenic
967412181 3:189178057-189178079 CTGAGCATGCAGCAGTGTGCTGG + Intronic
970832170 4:20353024-20353046 ATTTGAATGCAGCAGTATAACGG + Intronic
981776082 4:148369147-148369169 TTTTGCATGAAGCAGAATGAGGG - Intronic
989221716 5:38973327-38973349 ATGTGCATGCTGCAGTGTTCAGG + Intronic
994203237 5:97002388-97002410 ATGGGCATGTTACAGTATGAAGG + Intronic
994672861 5:102783712-102783734 ATGTGCATGCAGCAGTATGAGGG + Intronic
996195864 5:120606082-120606104 ATGTGCATGCTGCATGATGGTGG + Intronic
997340405 5:133140473-133140495 ATGCGCAGGCAGGAGCATGATGG + Intergenic
1002357708 5:178644324-178644346 ATTTGCCTGCAGCAGCATGAAGG - Intergenic
1002778662 6:349718-349740 ATGTGAATGCACCAGGCTGAGGG + Exonic
1003798080 6:9628687-9628709 ATGTGCATGCAGCTGTTGGATGG + Intronic
1004098331 6:12582076-12582098 TTGTGCTTGCAGCATTTTGAAGG - Intergenic
1009037614 6:58136833-58136855 ATGTGCATGCATCTTTATGGTGG - Intergenic
1011976476 6:93306466-93306488 GTGTGCATGGCACAGTATGATGG + Intronic
1012230946 6:96761044-96761066 ATGTGCATGCTGCAGGTTTAGGG - Intergenic
1013197121 6:107854479-107854501 ATTTGCATGCAAAAGAATGAAGG - Intergenic
1013860091 6:114625383-114625405 CTGTGCATGCACCAGGATGGGGG + Intergenic
1015498176 6:133902493-133902515 ATATCCATGTAGCAGAATGATGG - Intergenic
1017623469 6:156324197-156324219 ATGTGTATTCTGCAGTATGTAGG + Intergenic
1018903365 6:168062190-168062212 AAGTGCCCGCAGCAGTGTGAGGG + Intronic
1019088899 6:169507927-169507949 AAGTACATGCAGCAGTTGGAAGG - Intronic
1019427764 7:985370-985392 ATGGGCGTGCAGCAGGAGGACGG + Intronic
1019947385 7:4340831-4340853 ATCTGCCAGCAGCAGCATGAAGG + Intergenic
1022486357 7:30781223-30781245 CTATGCATGCAGCAATATGCAGG - Intronic
1022556884 7:31306871-31306893 ATGTGGCTGGAGAAGTATGAGGG + Intergenic
1027342190 7:77221424-77221446 ATGTGCATGCCTGTGTATGAAGG - Intronic
1028061257 7:86319626-86319648 GTGTGAATGCTGCAGAATGATGG - Intergenic
1028265026 7:88712858-88712880 ATGTGCATGAAGCAACATTAAGG - Intergenic
1029614840 7:101649767-101649789 ATGTGGCTGCTGCAATATGAAGG + Intergenic
1030088022 7:105833720-105833742 ATATGCATGCTGGAGTATCAAGG + Intronic
1030240191 7:107314080-107314102 AAGTACATGCAGCAATATGGGGG + Intronic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1031824080 7:126541229-126541251 ATGTGCAGACAGCAGTCTGGAGG + Intronic
1031990429 7:128194596-128194618 ATGTGGCTGCAACAGAATGATGG + Intergenic
1034854438 7:154528859-154528881 AGGTGCAGGGAGCAGTGTGAGGG + Intronic
1035539057 8:417469-417491 ATGTGTATGGTGCAGTAAGAGGG + Intronic
1035574753 8:697424-697446 GTGGGCATGCAGCAGGATGACGG - Intronic
1042507326 8:69574507-69574529 ATGTGAATACAGCAGTAGCAGGG - Intronic
1042937995 8:74079901-74079923 ATGTGCATGCAGATGTGTGCAGG + Intergenic
1051783247 9:20713268-20713290 ATGTGCATACAGCAGAGTGAAGG - Intronic
1056802763 9:89704816-89704838 TTGTGCATGCCTCAGTATGTAGG + Intergenic
1056884641 9:90429383-90429405 ATGTGCATACAGCAGACTTAGGG + Intergenic
1059670247 9:116484378-116484400 ATGAGCATGAGGCAGTATCAGGG + Intronic
1060421684 9:123473637-123473659 TTGTGTAGGAAGCAGTATGAGGG + Intronic
1195858138 X:109352609-109352631 ATCTGCATGCTGCAGTTTAAGGG - Intergenic
1198528889 X:137529664-137529686 ATGAGTATGCAGCAGCAAGAAGG + Intergenic
1200698867 Y:6385362-6385384 ATATGCATGCACTAGTTTGAGGG - Intergenic
1200703997 Y:6426077-6426099 ATGTGCATGCACAAGTCTCAGGG - Intergenic
1200927371 Y:8666555-8666577 ATGTGCATGCAGTAGCCTCAGGG + Intergenic
1200938713 Y:8760874-8760896 ATGTGCATGCACTAGTTTCAGGG - Intergenic
1200981946 Y:9270605-9270627 ATGTGCATGCACTAGTCTCAGGG - Intergenic
1201030114 Y:9738631-9738653 ATGTGCATGCACAAGTCTCAGGG + Intergenic
1201035245 Y:9779337-9779359 ATATGCATGCACTAGTTTGAGGG + Intergenic
1202128469 Y:21589125-21589147 ATGTGCATGCACTAGTCTCAGGG + Intergenic
1202177151 Y:22108414-22108436 ATGTGCATGCACTAGTTTCAGGG - Intergenic
1202178445 Y:22119077-22119099 ATGTGCATGCACAAGTCTCAGGG - Intergenic
1202212916 Y:22467317-22467339 ATGTGCATGCACAAGTCTCAGGG + Intergenic
1202214210 Y:22477970-22477992 ATGTGCATGCACTAGTTTCAGGG + Intergenic