ID: 994675321

View in Genome Browser
Species Human (GRCh38)
Location 5:102814023-102814045
Sequence CTGTGGTAGGGGCAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994675314_994675321 25 Left 994675314 5:102813975-102813997 CCTGTTGCTTACTGTTTGTCATA 0: 1
1: 0
2: 1
3: 15
4: 163
Right 994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG No data
994675313_994675321 30 Left 994675313 5:102813970-102813992 CCATACCTGTTGCTTACTGTTTG 0: 1
1: 0
2: 0
3: 12
4: 171
Right 994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994675321 Original CRISPR CTGTGGTAGGGGCAGGAGAC TGG Intronic
No off target data available for this crispr