ID: 994679734

View in Genome Browser
Species Human (GRCh38)
Location 5:102870991-102871013
Sequence GTTAACTATCCCTTTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994679732_994679734 16 Left 994679732 5:102870952-102870974 CCAGTTCATGGTCATAGTATGGT 0: 1
1: 0
2: 0
3: 9
4: 95
Right 994679734 5:102870991-102871013 GTTAACTATCCCTTTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994679734 Original CRISPR GTTAACTATCCCTTTGGTGT TGG Intronic
No off target data available for this crispr