ID: 994689838

View in Genome Browser
Species Human (GRCh38)
Location 5:103004064-103004086
Sequence GTGCTTAAGCAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994689838_994689844 5 Left 994689838 5:103004064-103004086 CCCTTCTCCATCTGCTTAAGCAC 0: 1
1: 1
2: 1
3: 14
4: 202
Right 994689844 5:103004092-103004114 AAGCTAGCTTCTTCGCAAGGTGG No data
994689838_994689843 2 Left 994689838 5:103004064-103004086 CCCTTCTCCATCTGCTTAAGCAC 0: 1
1: 1
2: 1
3: 14
4: 202
Right 994689843 5:103004089-103004111 GGAAAGCTAGCTTCTTCGCAAGG 0: 1
1: 0
2: 0
3: 20
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994689838 Original CRISPR GTGCTTAAGCAGATGGAGAA GGG (reversed) Intronic
900935570 1:5764296-5764318 GGGCTTAAGCAGCTGGAGGGTGG - Intergenic
901909426 1:12443779-12443801 GTTCTTTAGCAGAAGGAAAAGGG - Intronic
903556587 1:24198083-24198105 ATTCTTAGGCAGATGGAGACAGG - Intergenic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
905889445 1:41510428-41510450 ATGCTGAAGCAGTTGGAGAGAGG + Exonic
907379607 1:54075315-54075337 TTGCTTAGGCAAGTGGAGAAGGG + Intronic
907843383 1:58178467-58178489 TTGCTTCAGCAGATGCAGAAGGG + Intronic
909246744 1:73295935-73295957 GTGCTTAATAATATTGAGAAAGG + Intergenic
910349360 1:86277909-86277931 CTCCTTAAGCAGAAAGAGAAAGG + Intergenic
910803295 1:91165990-91166012 GTGCTTGTGCAGAGAGAGAAAGG + Intergenic
913228977 1:116725436-116725458 GTCCTTCAGCAGCTGGACAAGGG + Intergenic
913502356 1:119482981-119483003 GTGTTTAAGAAGATTGAAAAAGG - Intergenic
914221412 1:145685398-145685420 GTGCTAATGCACATGGTGAATGG - Intronic
914473978 1:148008265-148008287 GTGCTAATGCACATGGTGAATGG - Intergenic
915909110 1:159901284-159901306 AGGCTTAATCAGAGGGAGAAGGG + Intergenic
919200001 1:194343907-194343929 GTTCTTAATGAGATGTAGAATGG + Intergenic
919918711 1:202155213-202155235 GCTCTTAAGCAGCTGGAGATTGG + Intronic
923195698 1:231664593-231664615 CTGCTTTTGAAGATGGAGAAAGG + Intronic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1066811823 10:39348570-39348592 TTGATTGAGCAGTTGGAGAACGG - Intergenic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1070680495 10:78445714-78445736 GTGCTGGAGCAGGTGGGGAAGGG - Intergenic
1071788644 10:88931476-88931498 GTGCTTAAGCAGAAGCTTAAAGG - Intronic
1076775990 10:132698632-132698654 GTGATTCAGCAGATGAGGAAGGG - Intronic
1078537138 11:12184342-12184364 GTACTTAACCAGGAGGAGAATGG - Intronic
1079384117 11:19963754-19963776 GTGCTTATGCAGAAAGTGAATGG + Intronic
1079528184 11:21415739-21415761 GAGGTTAAGCAAAAGGAGAAGGG + Intronic
1081523587 11:43907237-43907259 GTGTTTAAGCAGATAAAGATTGG + Intronic
1083022175 11:59518441-59518463 ATGATCCAGCAGATGGAGAAAGG + Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1086206733 11:84267444-84267466 GTGCTAAAGAAGATGAAGGACGG - Intronic
1086377297 11:86214491-86214513 GTGCGAAAGTAGATGGATAAGGG + Intergenic
1087209450 11:95431865-95431887 GTGCTAAAGCCACTGGAGAAGGG + Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1093006857 12:14060667-14060689 GTGCTAGTGTAGATGGAGAAAGG + Intergenic
1093067692 12:14675664-14675686 GTGCCTCAGCAGCTGGAGAATGG + Intronic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1097713867 12:62944443-62944465 GAGATTCAGCAGATGCAGAAAGG - Intergenic
1097979568 12:65724189-65724211 GGGCTTAACAAGATGGTGAAAGG + Intergenic
1100258403 12:92907532-92907554 GTGGCCAAGGAGATGGAGAAAGG - Intronic
1100901373 12:99244767-99244789 GTTCTTAGGCAGAAGAAGAAGGG - Intronic
1101545028 12:105704402-105704424 GTTGTTAAGCAAAGGGAGAAGGG - Intergenic
1105503722 13:20992610-20992632 GGGCTTCAGCAGAAGAAGAAAGG + Intronic
1106310026 13:28545827-28545849 GTGCTTGAGCAGGTGGGTAAGGG + Intergenic
1108782705 13:53855911-53855933 ATGCTTAGGCGGATGGGGAAGGG - Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1111760697 13:92460723-92460745 GTGTTTAAGGAAATGGAGACAGG + Intronic
1112009113 13:95279252-95279274 GCGCTTTAGCAGATAGAGAAGGG - Intronic
1114137078 14:19865626-19865648 GTGTTTAACCATAGGGAGAATGG + Intergenic
1114600644 14:23953473-23953495 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114604881 14:23988617-23988639 GTGGACAAGCAGATGCAGAAGGG + Intronic
1114610328 14:24036164-24036186 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1115694953 14:35886960-35886982 GTGATTAAGCCAATGGAGAATGG + Intronic
1115952090 14:38732808-38732830 GTGGTTGAGCAGAGGGAAAAAGG + Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1117747753 14:58888399-58888421 GTGTTGAAGCAGATGGGCAAGGG - Intergenic
1127841832 15:62838472-62838494 GTGCTAAATCAGATGGAGGCAGG + Intronic
1131202766 15:90414206-90414228 GTACTTTGGGAGATGGAGAAGGG + Intronic
1131857995 15:96619243-96619265 GTTCTTAATCAGAAGCAGAAGGG + Intergenic
1132894228 16:2220314-2220336 GGGCTTAAGCAGAAGCAGGAAGG - Intergenic
1133390728 16:5407884-5407906 GTGTTTAAGCAGCTGGTGATGGG + Intergenic
1133396786 16:5453843-5453865 GTTCTCATGCAGAAGGAGAAAGG + Intergenic
1139101453 16:63772118-63772140 GTTCTTAAGAAGATGAAAAAGGG - Intergenic
1140054391 16:71512928-71512950 GTGCTGATGCATTTGGAGAAAGG - Intronic
1140997627 16:80276861-80276883 GTGATTAAGAAGATTGAGATGGG + Intergenic
1142378416 16:89718508-89718530 GTGGATAAGAAGATGGAGACTGG - Intronic
1146351560 17:32099418-32099440 ATTTTTAAGCAAATGGAGAATGG - Intergenic
1147428396 17:40357029-40357051 GTGGTCAGGCAGAGGGAGAAAGG - Intronic
1148504797 17:48118898-48118920 GTTCTTAAGAGGATGGGGAATGG + Intronic
1148843576 17:50515149-50515171 GAGCTGAAGAAGCTGGAGAAAGG - Intronic
1149723612 17:58869814-58869836 GTTCTGAAGCAGATTGTGAATGG - Intronic
1150751609 17:67868708-67868730 ATTTTTAAGCAAATGGAGAATGG - Intronic
1151802541 17:76386381-76386403 GTGCTTCAACAGGTGGTGAACGG + Exonic
1151849823 17:76683690-76683712 GTGCTTGAGAAGAATGAGAAGGG + Intronic
1157314614 18:46577219-46577241 ATGCTTAAGCAAAAAGAGAAAGG + Intronic
1160002587 18:75040860-75040882 GTGACAAAGCACATGGAGAACGG + Intronic
1163274454 19:16274450-16274472 GTACTTAATCAGATATAGAAAGG + Intergenic
1166559291 19:43721023-43721045 GTGCTTGAGAAGACAGAGAATGG + Intergenic
1167396749 19:49234613-49234635 GGAATTGAGCAGATGGAGAAAGG + Intergenic
925018377 2:548885-548907 GTGTTTGGGCAGATGAAGAAGGG - Intergenic
925234616 2:2267018-2267040 GTGCTTCAGCACAGGGAGGATGG + Intronic
925892503 2:8447033-8447055 GTGCTTAAGCAATTGGCTAAAGG - Intergenic
925942488 2:8834314-8834336 GAGCTTAGGGAGGTGGAGAAGGG - Intronic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
928664588 2:33537963-33537985 GTGCTTAAGCGTATTGAGCAAGG + Intronic
928905955 2:36367889-36367911 GTACATAAGAAAATGGAGAAAGG - Intronic
931339244 2:61382711-61382733 AAGCCTAAGAAGATGGAGAAAGG - Intronic
932575492 2:72960275-72960297 GTGCTTAATGAGATGGAGCCAGG - Intronic
932794743 2:74684599-74684621 AAGTTCAAGCAGATGGAGAAGGG + Intergenic
933117761 2:78496394-78496416 TTGCTTAAGCAGTTGGACACAGG - Intergenic
933698988 2:85241002-85241024 GTTTTTAAGGAAATGGAGAAAGG + Intronic
934096370 2:88609592-88609614 ATGCTTTAGCATGTGGAGAAAGG - Intronic
934511260 2:94946436-94946458 GTTCTTGGGTAGATGGAGAAGGG - Intergenic
935962945 2:108445301-108445323 ATGCCTAAGCAGATAGGGAAGGG + Intergenic
936491979 2:112979728-112979750 CTGCTTGAGCACATGGAGATGGG - Intronic
936831373 2:116652413-116652435 ATGCTTAAGCAGAACAAGAATGG + Intergenic
937246390 2:120496807-120496829 GGGCTGAAGCAGAAGGAGAAGGG - Intergenic
937463508 2:122109741-122109763 GTACTTAAGCAGATGTACAGAGG - Intergenic
937880102 2:126858424-126858446 GTGCTTCAGCAGCCAGAGAAAGG - Intergenic
944213378 2:197229807-197229829 GTGGTTAAGCACATGGACACTGG - Intronic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
947671507 2:231939418-231939440 GTGCTTAAGCAGATTGGGATCGG + Intergenic
947978109 2:234385069-234385091 GTGCTTAAGAAGAAGGGGAGTGG + Intergenic
948944429 2:241212297-241212319 GTGCTCAGGCAGGTGGAGGACGG + Intronic
1169338047 20:4773639-4773661 CTGATTCAGCAGATGGAGTAGGG - Intergenic
1170480745 20:16762540-16762562 GTGCTTAAAATCATGGAGAAAGG - Intronic
1170958078 20:20999973-20999995 GTGCTTTAGCAGATACATAAAGG + Intergenic
1171361005 20:24586349-24586371 ATGCTTGTGCTGATGGAGAAGGG - Intronic
1174986242 20:55456230-55456252 GTGATAAAGCAGAGGAAGAACGG + Intergenic
1175627445 20:60500918-60500940 GAGGTTATGCAGATGGGGAAAGG + Intergenic
1176239227 20:64068204-64068226 GTGCCTAGGCACATGGAGACTGG - Intronic
1178105830 21:29318265-29318287 GTGCTGATGCCGATGGAGAGAGG + Intronic
1178339383 21:31773236-31773258 GTGCTAAAGCAAAAGGGGAAAGG - Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1179623633 21:42634600-42634622 GTGGGTGAGCAGATGGACAATGG - Intergenic
1179726483 21:43344062-43344084 GTGCGTCGGCAGATGGAGACTGG - Intergenic
1180848849 22:19000620-19000642 ATGCTTAAGCGAATTGAGAAAGG - Intergenic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
949928419 3:9059700-9059722 CAGCTTAAGCAAATGGAGAACGG - Intronic
950983442 3:17333582-17333604 ATGCTTAAGCAGAGGGATAAGGG + Intronic
951400678 3:22228727-22228749 GTGCTTACCCAGATTGAGAGTGG - Intronic
953187815 3:40654642-40654664 GTGCTCAACAACATGGAGAAGGG + Intergenic
953791813 3:45953299-45953321 GTCCTTAACCAGAGGGAAAATGG + Intronic
954096521 3:48332982-48333004 GTGCCAAAGGAGATAGAGAAAGG - Intergenic
954877012 3:53808839-53808861 GTGCTTAAGGCCAAGGAGAAGGG - Intronic
956920622 3:73924986-73925008 GTGTTTGAGTAGATGGAGATGGG + Intergenic
958955523 3:100461803-100461825 ATGATTAATTAGATGGAGAATGG - Intergenic
961455140 3:127020327-127020349 GTGCTCAAGGAGATGGAGGTAGG + Exonic
962377142 3:134867734-134867756 GGGCTGAGGGAGATGGAGAATGG - Intronic
963069097 3:141287757-141287779 GTGCATAAGCACAGGAAGAAGGG - Intronic
963158282 3:142122777-142122799 GAGCCTAAGCAGGTGGAGAATGG + Intronic
963417881 3:145021965-145021987 ATGCTTAAGATGATGAAGAAGGG - Intergenic
967342994 3:188421727-188421749 AAGCTTAAGCAGATGGAGACAGG - Intronic
967776226 3:193388810-193388832 GTGGTTACAAAGATGGAGAATGG + Intergenic
969834625 4:9830570-9830592 GTGCCTAAGCAGAGTGAGACGGG - Intronic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
972165746 4:36281928-36281950 GTGCTCCAGCAGCTGGTGAAGGG - Intronic
972205887 4:36772253-36772275 GTGTTTTGGAAGATGGAGAAAGG - Intergenic
976046811 4:80958559-80958581 TTTCTTAAGAAGAAGGAGAAAGG + Intronic
978270154 4:106878967-106878989 GTGCTCAAGCAGGGTGAGAAGGG - Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
979466312 4:121042388-121042410 ATGCTTTTGGAGATGGAGAATGG + Intronic
979954990 4:126941495-126941517 GTGCTTAAGAAAATGGACATTGG + Intergenic
980601025 4:135024921-135024943 GGGATTAATCAGATGAAGAAGGG - Intergenic
980627163 4:135388573-135388595 GTGGTTAAGTATATGGATAAGGG + Intergenic
980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG + Intergenic
982964853 4:161893080-161893102 TTGCTTAACCAGATGGTAAATGG - Intronic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988508384 5:31843935-31843957 GTTTTTCAGCTGATGGAGAATGG + Intronic
990300558 5:54445488-54445510 GTGGTTAAGAACATGGAGTAAGG - Intergenic
994689838 5:103004064-103004086 GTGCTTAAGCAGATGGAGAAGGG - Intronic
995201177 5:109426595-109426617 GGGATGGAGCAGATGGAGAAGGG - Intergenic
995927104 5:117387080-117387102 GGGCACAAGCAGCTGGAGAAGGG - Intergenic
996539548 5:124615132-124615154 GTGCTTAAACCAAAGGAGAAGGG + Intergenic
997519663 5:134514671-134514693 GTCCTTAAGCATATGCAGGATGG - Intergenic
998062854 5:139132798-139132820 ATGCTAAAGCTGAGGGAGAAGGG + Intronic
1000285590 5:159823660-159823682 GTGCTCAGGCAGAGGGAGAGAGG + Intergenic
1001668450 5:173453571-173453593 GCCCTTAAGCAGCTGGAGATGGG - Intergenic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003050770 6:2779112-2779134 ATGCTTAAGCACATTGACAAAGG + Intronic
1004987217 6:21096026-21096048 GTGCTAAATTAGATGTAGAAAGG + Intronic
1005601130 6:27427227-27427249 GTTCTTAGACAGATGGAGAACGG + Intergenic
1007741225 6:44010755-44010777 GTGCTCAGGGAGATGGAGATGGG + Intergenic
1010156839 6:72804356-72804378 GAACTTAAGGAGATAGAGAATGG - Intronic
1010282390 6:74036651-74036673 TGGCTTGAGCAAATGGAGAATGG - Intergenic
1010749349 6:79600620-79600642 GTTCTGAACCAGATTGAGAATGG - Intergenic
1010994749 6:82520365-82520387 GTGCTTAGGAACATGGAGTATGG - Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1013504186 6:110782744-110782766 GTGTTTAACCTGATGGAGAAAGG - Intronic
1013773656 6:113654490-113654512 GTGCTTAAGCCAATGGAGAAGGG - Intergenic
1013984725 6:116176706-116176728 AGGCTTAAGCAGCTGGAGGAAGG - Intronic
1014010987 6:116475386-116475408 ATCCTTAAGCTGATGGTGAAAGG + Intergenic
1014771615 6:125464206-125464228 GTGCTTAAGTAGAGAAAGAATGG + Intergenic
1015485215 6:133762174-133762196 GTGCTTAACCAATTGGAGACAGG - Intergenic
1016063311 6:139653124-139653146 GGGCTGAAGCATATGCAGAATGG - Intergenic
1016352593 6:143184142-143184164 ATGCTTAATCAGAGGGTGAAAGG - Intronic
1017668688 6:156748501-156748523 GTGGTAAAGGAGATGGTGAAAGG - Intergenic
1018927229 6:168214911-168214933 GTGGTTAAGCGGCTGGGGAAGGG - Intergenic
1021958948 7:25853116-25853138 GTGTTTAAACAAATGGAGATGGG - Intergenic
1022804160 7:33805150-33805172 GTGCCTAGGCTGATGGAGCAGGG - Intergenic
1028124304 7:87094273-87094295 CTGCTTCAGTACATGGAGAAAGG - Intergenic
1029459667 7:100687561-100687583 GTGCTGAGGCTGATGGGGAAAGG - Exonic
1030218369 7:107070675-107070697 GTGATTTAGCAGATGGGTAAAGG + Intronic
1030930141 7:115512594-115512616 GTGCTTTAGGAGATGGAGGCAGG - Intergenic
1032986358 7:137342327-137342349 TTGCTTTAGCAGCTTGAGAAAGG - Intronic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1035129299 7:156637665-156637687 GTGCTTAGTCACAAGGAGAAGGG - Intergenic
1035323611 7:158050754-158050776 GTACTTGAGGAGATGGAGACTGG - Intronic
1039092586 8:33847932-33847954 GTGCTTTAGCAGAGGGTAAATGG + Intergenic
1041344388 8:56881418-56881440 TTGCTTCAGCAGAGGGTGAATGG + Intergenic
1042864225 8:73343576-73343598 ATGCTGTAGTAGATGGAGAAGGG + Intergenic
1042948851 8:74180353-74180375 GTGCTTAAGAAGATGGCAGAGGG + Intergenic
1043208271 8:77475579-77475601 GGGCTTCAGCAGATGGGGTAAGG + Intergenic
1043927971 8:86059515-86059537 GTGCTTTTGAAGATGGAGAGAGG - Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044354008 8:91199222-91199244 CTGCTTAAGTAGTTGGAGAAAGG + Intronic
1044829758 8:96235660-96235682 GTGCTTACGCAGGTGCTGAACGG - Intergenic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1047513809 8:125536291-125536313 GAGCTTAAGCTGAAGGAGCAGGG + Intergenic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1050947644 9:11546429-11546451 GAGCTAAAGCAGCTGGTGAAGGG - Intergenic
1051888901 9:21923687-21923709 GTCCTTAAGCACATTGAGGAGGG - Intronic
1054899248 9:70350638-70350660 ATGCTTAATCAGAGGAAGAAAGG + Intronic
1055118217 9:72628038-72628060 ATGCTTAAGGAGCTGCAGAAGGG + Exonic
1056055275 9:82816128-82816150 GTGCATAAGAAGATGAATAAAGG + Intergenic
1058534038 9:105936690-105936712 GTGCTTAAGAACATAGAGACTGG + Intergenic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059552016 9:115238494-115238516 GCTCTTATGCATATGGAGAAAGG + Intronic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1187135395 X:16542693-16542715 GTACCTTAGCAGAGGGAGAAGGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189985165 X:46546864-46546886 GTGTTTATGCAGAAAGAGAAGGG + Intergenic
1196013030 X:110908361-110908383 GAACTGAAGGAGATGGAGAATGG - Intergenic
1196101873 X:111855223-111855245 GTGCTCAAGGAGAAGAAGAATGG - Intronic
1196872509 X:120126071-120126093 GTGCTCCAGCAGAAGGTGAAAGG - Intergenic
1199001272 X:142639720-142639742 GTGATTAATCATATGGATAATGG - Intergenic