ID: 994690739

View in Genome Browser
Species Human (GRCh38)
Location 5:103016470-103016492
Sequence CTCCAAAGGTGCCCTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994690739_994690746 21 Left 994690739 5:103016470-103016492 CCAGACCCAGGGCACCTTTGGAG 0: 1
1: 0
2: 1
3: 26
4: 170
Right 994690746 5:103016514-103016536 GTCAGCAGCACAATAATTTAAGG 0: 1
1: 0
2: 0
3: 10
4: 159
994690739_994690744 -6 Left 994690739 5:103016470-103016492 CCAGACCCAGGGCACCTTTGGAG 0: 1
1: 0
2: 1
3: 26
4: 170
Right 994690744 5:103016487-103016509 TTGGAGGCTTCCAGAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994690739 Original CRISPR CTCCAAAGGTGCCCTGGGTC TGG (reversed) Intronic
900282391 1:1879180-1879202 CCCCACAGGTGCCCTGGGCCTGG + Intronic
901746477 1:11377046-11377068 CTCCTTATGTGCCCTGGGCCTGG + Intergenic
902077887 1:13802125-13802147 CTCAGAATGTGCCCAGGGTCCGG - Intronic
905018865 1:34794960-34794982 CTGAGGAGGTGCCCTGGGTCGGG - Exonic
905296015 1:36954951-36954973 GTCCATAGGAGCCCTGGGTAAGG + Intronic
906262493 1:44405089-44405111 CTCCAGGAGTGCCCTGGGTCTGG + Intergenic
906332991 1:44903371-44903393 CTACAAAGGTCCCCAGGCTCAGG + Intronic
907541823 1:55222423-55222445 CACCAAAGGTGCCCTGGTCCTGG + Intergenic
912746303 1:112248335-112248357 GTCCACAGATGCCTTGGGTCAGG + Intergenic
913146001 1:115990639-115990661 GTACAAAGCTGCCATGGGTCAGG - Intronic
915018708 1:152760290-152760312 TCCCATAGGAGCCCTGGGTCTGG - Exonic
915623357 1:157099414-157099436 CTCCAACGGTGGCCTAGGGCAGG - Intronic
917854459 1:179089692-179089714 CTCCACCTGAGCCCTGGGTCGGG + Intronic
918621340 1:186609369-186609391 CTGGAAAAGTGCCCTGGGGCAGG + Intergenic
920799667 1:209174336-209174358 TCCCAAAGGTGCCCAGGCTCTGG - Intergenic
922473473 1:225890564-225890586 GTCCAAATGTGCTCTGAGTCAGG - Intronic
922705675 1:227788835-227788857 CTCCAAAGGTGGCTTGGGGCAGG + Intergenic
922841988 1:228650215-228650237 CTCCACAGGTGCCCAAGGCCAGG - Intergenic
923812171 1:237330806-237330828 CTCCTAAGGTAAGCTGGGTCTGG + Intronic
924898756 1:248372531-248372553 CACTAAAAGTGCCCTGGTTCAGG + Intergenic
1064672810 10:17733275-17733297 CTTCAAATATCCCCTGGGTCAGG - Intergenic
1065920971 10:30392595-30392617 CTCCAAGGCTGCCCAGGATCAGG + Intergenic
1066178836 10:32939874-32939896 CTGCACAGCTGCCCTGGGTCAGG + Intronic
1067708144 10:48626527-48626549 TTCCGAATGTGCCATGGGTCTGG - Intronic
1073138431 10:101232258-101232280 TTCCAAAGGTGGCCTGGATAAGG - Intergenic
1073467141 10:103700814-103700836 CTCCCATGGTTCCCTAGGTCTGG - Intronic
1074987981 10:118674195-118674217 TTCCAGAGTTTCCCTGGGTCAGG + Intronic
1076119940 10:127927572-127927594 CTGCAGAGATGCCCTGGGTTGGG - Intronic
1076379146 10:130013510-130013532 TTCCAAAGGCAGCCTGGGTCTGG + Intergenic
1076704628 10:132294354-132294376 CCCCAAAGATGCCTTGGGGCGGG - Intronic
1076841569 10:133048508-133048530 CTCCACAGGGGCCCAGGCTCCGG + Intergenic
1079983844 11:27179572-27179594 CTCCAGAGGTACCCTGAGGCAGG - Intergenic
1080460494 11:32450656-32450678 CTCGAAGGGTGTCCTGGGTAAGG - Intergenic
1080515323 11:33014967-33014989 CTCCAAAGGAACTGTGGGTCGGG - Intergenic
1080614699 11:33935792-33935814 CTCTCAAGTTGCCATGGGTCTGG - Intergenic
1081547696 11:44083426-44083448 CCTCAAAGGTGCCCTTGGGCAGG - Exonic
1085122638 11:73976961-73976983 CACCACAGGTGCCCTGGCTGTGG - Exonic
1085322486 11:75583527-75583549 CTCCGAAGATGCCCAGGCTCGGG - Intergenic
1089643683 11:119864225-119864247 CTCTAAAGATTCCCTGGGCCTGG - Intergenic
1090780703 11:130003493-130003515 CTCTCAAGGTGCGGTGGGTCAGG - Intergenic
1094025164 12:25954361-25954383 CTCCAAAGCTATCCTGGTTCAGG - Intergenic
1094172233 12:27505687-27505709 CTAAAAAGGTACCCTGGGTTAGG - Intergenic
1098487598 12:71039750-71039772 CTCAAAAGGAGCCCTGTGTCTGG - Intergenic
1098748304 12:74266930-74266952 CTCCCAAGGAGCCCATGGTCAGG + Intergenic
1103237957 12:119389708-119389730 CCCTAAAGATGCCTTGGGTCTGG - Intronic
1104624361 12:130339227-130339249 CTCCACAGGTGCCAAGGGCCGGG - Intronic
1106259782 13:28056325-28056347 CCACAGAGGTGCCCTGGGTCAGG - Intronic
1108228657 13:48316942-48316964 CGCCCAAGGTGCCCTGGTCCTGG + Intronic
1109502514 13:63255958-63255980 GAGCAAAGGGGCCCTGGGTCTGG + Intergenic
1109987995 13:70016262-70016284 CTCCAGAGCTGGCCTGGGCCAGG + Intronic
1112433147 13:99370643-99370665 CTCAAAAGGTGCCCCTGGGCAGG + Intronic
1114327266 14:21602001-21602023 CTCCAAAGGCCCCCTGGATGGGG - Intergenic
1122021634 14:98842498-98842520 TTGCAAAGGTGCCCTGGGGAAGG + Intergenic
1122976355 14:105172449-105172471 AGCCAAAGCTGCCCTGTGTCGGG - Intergenic
1123011298 14:105350781-105350803 CTGCAAATGTGCTCTGCGTCGGG - Intronic
1124015006 15:25866417-25866439 CTGCAAAGGTGCTGTGGCTCAGG + Intergenic
1125591065 15:40854698-40854720 CTCCCCAGGTGCCCTGGATCAGG + Intronic
1128551373 15:68600010-68600032 CTCCAGAGGGGACCTGGGGCTGG + Intronic
1129394571 15:75236867-75236889 CTCCAAAATTGTCCTTGGTCAGG - Intergenic
1129677286 15:77638670-77638692 CTCGAAAGGTGCCCAGCATCAGG + Intronic
1129937148 15:79460242-79460264 CTCCAAAGGTGGGCCGGGTCTGG - Intronic
1131132466 15:89909084-89909106 CTGAAAAGGAGCCCTGGGTGAGG + Intronic
1132971646 16:2692113-2692135 CTGGAAAGGTGCCATGGCTCCGG + Intronic
1133231733 16:4370164-4370186 ATCCACAGATGCCCAGGGTCAGG - Intronic
1133318117 16:4896573-4896595 GACCAAAGGTGACCTGGGGCTGG + Intronic
1136023608 16:27455771-27455793 TTCCACCGGTGCCCTGGGACTGG - Intergenic
1137752869 16:50879840-50879862 CTCCAGAGCTGTCCTAGGTCGGG - Intergenic
1139642106 16:68299189-68299211 CTCCAGAGGAGCCCTGGGATGGG - Exonic
1140802301 16:78499580-78499602 CGGCAAAGGGGCCCTGGGCCAGG - Intronic
1141740070 16:85885235-85885257 CCGCTAAGGTGCCCTGGCTCTGG + Intergenic
1142009949 16:87708897-87708919 CAGCAGAGGGGCCCTGGGTCAGG + Intronic
1144055511 17:11537218-11537240 CTCCAAGGGGACCCTGAGTCAGG + Intronic
1144637230 17:16918085-16918107 TTCCCCAGGTGCCCTGGGTCTGG - Intergenic
1144736675 17:17559480-17559502 CTCCACAGGTGCCCAGGCTCTGG - Intronic
1144956397 17:19020984-19021006 TCCCAAAGGTGCCCAGGCTCTGG + Exonic
1145788308 17:27608421-27608443 GTACACAGGAGCCCTGGGTCTGG + Intronic
1148889529 17:50798039-50798061 TTGCAAAGGAGCCCTGGGTCAGG + Intergenic
1150075463 17:62188296-62188318 CTTCCAAGCTGCCCTGGGTCAGG + Intergenic
1150798370 17:68258872-68258894 CTCCACAGGTGCCCAGGATCAGG - Intergenic
1151466396 17:74288617-74288639 CTACAAAGGTGCTCTGGGATGGG - Intronic
1152294370 17:79458039-79458061 CTGCAAAGATGGCCTGGGCCTGG - Intronic
1152361354 17:79834573-79834595 CTCCAAAGGCCTCCTTGGTCGGG + Exonic
1152559286 17:81069819-81069841 CTCCCAAGGTGCCCTGGGCATGG - Intronic
1153223342 18:2880500-2880522 GTCCACAGGTGCCTTGGGTATGG - Intronic
1156823215 18:41398044-41398066 CTCTAAAGGATTCCTGGGTCAGG + Intergenic
1161736687 19:5995900-5995922 CTCCCAAAGTCCCCTGGGTGCGG + Intronic
1163205624 19:15800525-15800547 TTCCAAATGTGCCCTGGGAAGGG + Intergenic
1163230063 19:15995669-15995691 CAGCAAAGGGGCCCTGGGCCTGG - Intergenic
1163551795 19:17969561-17969583 GTCCTAAGGTGCCCTGGGCAGGG - Intronic
1164823648 19:31268422-31268444 CTCCAAAAGGGCCATGGTTCTGG - Intergenic
1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG + Intronic
1167642700 19:50690536-50690558 CTACAAGTGTGCCCTGGGACAGG - Intronic
1167749608 19:51371821-51371843 CTCCCCAGGTGCCCTGAGCCTGG - Exonic
1167764167 19:51469217-51469239 CTCCACTGGAGCCCTGGCTCAGG - Intergenic
1167772830 19:51531505-51531527 CTCCATAGGGGCCCTGGCTCAGG - Exonic
1168411788 19:56144836-56144858 CTCCAGAGGTGTTCTGGGGCGGG + Intronic
927909951 2:26890386-26890408 CTCCAAAAGCACCCTGGGTAGGG + Intronic
928932418 2:36637694-36637716 CTCCAAACCTGCCCGGGGCCTGG + Intronic
930400669 2:50880858-50880880 ATCCAAAGGTTCCCTGCCTCAGG + Intronic
932659277 2:73638641-73638663 CAGCAATGGTGCCCTGGGCCTGG - Intergenic
935094784 2:99934141-99934163 CACCAGAGGTGCCCTTGGACTGG + Intronic
936528570 2:113259068-113259090 GTCCAAGGGTTCCCTGGGTAGGG + Intronic
936574783 2:113643980-113644002 CTCCAGAGCTTCCCTGGGACGGG - Intergenic
937269269 2:120637667-120637689 CTCCAAAGCTGCCCTGGAGTAGG - Intergenic
941753825 2:169163585-169163607 CTCCAAAAGAGCACTAGGTCAGG + Intronic
945739872 2:213646106-213646128 CTCCAAACCTGCCCCAGGTCAGG + Intronic
948240557 2:236429630-236429652 CTCCACAGGTTCTCTGGGCCAGG - Intronic
948850273 2:240702264-240702286 CTCCACAGTGGCCCTGGGTCAGG + Intergenic
1169034280 20:2436809-2436831 CTCCAGAGCTGCCTGGGGTCAGG - Intergenic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1171464730 20:25319531-25319553 CTCCAGGGCTGCCCTGGCTCCGG + Intronic
1173248420 20:41351913-41351935 CCCCAAAGGTGCCTGGGTTCTGG + Exonic
1175550993 20:59817601-59817623 CTCCATAAGTGACCTGGGCCAGG + Intronic
1175591024 20:60192158-60192180 CTGCAAATGTGCCCTGGTTCAGG - Intergenic
1175657173 20:60780988-60781010 CACCAAATGTCCCCTGGGTGGGG + Intergenic
1180211492 21:46297604-46297626 CTCCGAAGAGGCCCCGGGTCAGG - Exonic
1180844103 22:18972170-18972192 CACCAAGGGTGCCCAGGGTCTGG - Intergenic
1181057367 22:20266541-20266563 CACCAAGGGTGCCCAGGGTCTGG + Intronic
1184457105 22:44616939-44616961 CTCCCAAGCTGACCTGGGTGGGG - Intergenic
1184653155 22:45928384-45928406 CCCCACAGGTGCACAGGGTCGGG + Intronic
1184689752 22:46112162-46112184 CTCCCCAGGGGCCCTGGTTCTGG - Intronic
1185425390 22:50766896-50766918 CTCCAGAGCTTCCCTGGGACGGG + Intergenic
950494767 3:13327183-13327205 CTCCACAGGTTCCCTTGCTCAGG + Intronic
950647153 3:14383880-14383902 CTCCAAAGGTGGCAGGGGCCTGG + Intergenic
954294423 3:49666215-49666237 CTTCAAGGGAGCCCTGGGGCTGG + Intronic
954970971 3:54651587-54651609 TTCCAAAAGTGCCCTGAGCCAGG - Intronic
955639865 3:61070671-61070693 CTCAAAAGGTGTCCTGGGAAGGG - Intronic
957933714 3:86915225-86915247 CTCCCAAGCTGCCCTGTGTGCGG - Intergenic
963733567 3:148994179-148994201 CGCCAAAGGTGCCCTGGTCCTGG + Exonic
967553102 3:190823000-190823022 CTCCAGAGCTTCCCTGGTTCTGG + Intergenic
968463008 4:735146-735168 CTCCTGGGGTGCCCTTGGTCAGG - Intronic
968493169 4:901334-901356 CTCCACGTGTGCCCTGGGTGGGG - Intronic
968649500 4:1754874-1754896 CTCCAAATCTGCCCTGGGCCAGG + Intergenic
969241368 4:5900628-5900650 CTCCAACCGTGCCATGGGGCAGG - Intronic
970572941 4:17400383-17400405 ACCCAAAGGTGCCCTGGCTGTGG + Intergenic
971022011 4:22546423-22546445 CAGCAATGGGGCCCTGGGTCTGG + Intergenic
971387202 4:26151782-26151804 CTCCAAAGGAGGCCTTGGCCTGG + Intergenic
974084218 4:57242261-57242283 CTCCCAAGGCCCCATGGGTCTGG - Intergenic
976765367 4:88592730-88592752 CTCCAGAGACGACCTGGGTCTGG + Intronic
984635331 4:182104208-182104230 GGCCAGAGGTGCCCTGGCTCTGG - Intergenic
985644780 5:1079762-1079784 CTCCAGAGAAGCCCTGGGTGTGG - Intronic
988482325 5:31640352-31640374 CTCCAGACCTGCCCTGGGACTGG + Intronic
989161770 5:38398089-38398111 CTCCAGAGGGGCTCTGGGTGTGG + Intronic
989441293 5:41475057-41475079 CTCCAAAGGTGCTGTAGGTGGGG + Intronic
994690739 5:103016470-103016492 CTCCAAAGGTGCCCTGGGTCTGG - Intronic
996318707 5:122190263-122190285 CTCAAAAGTTGCCCTGGTTGTGG + Intergenic
998651280 5:144124297-144124319 CTCCAAAGGAGCCCTGGGCCAGG - Intergenic
999251830 5:150187133-150187155 CTCCAAAGCTGCCCTGGCGGAGG - Intergenic
1000973108 5:167736664-167736686 CTCCACAGAAGCCCTGGCTCAGG + Intronic
1001590231 5:172859728-172859750 CTCCGCAGGTGCCCTTGGACAGG + Intronic
1001681245 5:173558529-173558551 CAGCAAATGTGCCCTGAGTCAGG + Intergenic
1003163035 6:3652142-3652164 TGCCAAACGTGCCCTGGGTGAGG + Intergenic
1003583031 6:7359695-7359717 CTCCAAAGATATCCTGGGTTTGG + Intronic
1003682319 6:8268290-8268312 CTCCTACGGTGGCCTGGGTCAGG + Intergenic
1006148370 6:31972432-31972454 CTCCAAAGGTCTCCGGGATCAGG - Exonic
1006271284 6:32969008-32969030 CTCCAAAGTTGCCCTCGGCTTGG - Intronic
1007655348 6:43448146-43448168 CTGGAAAGGTGGCCTGGGTCAGG - Intronic
1009413420 6:63392398-63392420 CTCCAAAGGGACCCTGTCTCAGG + Intergenic
1012291281 6:97458597-97458619 TTCCAAAGTTGCTCTGGATCAGG - Intergenic
1014811280 6:125889088-125889110 CTCCAAAGGTACTATTGGTCTGG - Exonic
1018462014 6:164007429-164007451 CTCCACAGAAGCTCTGGGTCAGG - Intergenic
1021565163 7:22009693-22009715 CTCCAAAGGTGTCAGGGGTATGG + Intergenic
1022791503 7:33693621-33693643 CTCCCAAGGTGATCTGGGGCTGG + Intergenic
1023866624 7:44241500-44241522 GTCCAGAGGGGCCCTGGGCCAGG - Intronic
1024973888 7:55095501-55095523 CTCCCAAGCTGCCCTGGGCAGGG - Intronic
1034247182 7:149655431-149655453 TTCCAAAGATGCCCTTTGTCAGG - Intergenic
1035522569 8:286985-287007 CTGCAAAGGGGCCCTGCGTGAGG + Intergenic
1035581156 8:739471-739493 CTTCCAAGGTGCGCTGGGGCCGG - Intergenic
1037315396 8:17595328-17595350 TCCCAAAGGTGCCCAGGGTCTGG + Intronic
1037711707 8:21360457-21360479 CTTCAAAGGAGCCCTGGGCAGGG - Intergenic
1042737162 8:72002444-72002466 TCCCAAATGGGCCCTGGGTCTGG + Intronic
1042879315 8:73469753-73469775 CTCCCCAGGTGCCCTCTGTCTGG - Intronic
1042920516 8:73914944-73914966 CACCAAAGGTGTCCTGGCCCTGG - Intergenic
1047015998 8:120724171-120724193 CTGCAAAGGAGCCCTGTTTCAGG + Intronic
1048880296 8:138866974-138866996 CTCCCAAGGTGCCCTTGGATAGG - Intronic
1049478471 8:142807811-142807833 CTGCAAAGCTGCCATGGGACAGG + Intergenic
1049557380 8:143289707-143289729 TTCCAAATGTGCCCTGCCTCAGG - Intronic
1051160567 9:14203200-14203222 CTCAAAAGATGCCATGGGCCTGG - Intronic
1056283900 9:85069269-85069291 CAACACAGGGGCCCTGGGTCTGG - Intergenic
1056816320 9:89803787-89803809 CTCCAAAGGCTCCCTGTGGCTGG + Intergenic
1057198580 9:93128457-93128479 CTCCCAGGCTGCCCAGGGTCTGG + Intronic
1060051916 9:120383892-120383914 CCACAAAGGAGCCCTGGGCCTGG + Intergenic
1060969477 9:127730108-127730130 CTCCCCAAGTGCCCTGGGCCAGG + Intronic
1061035880 9:128114160-128114182 CTCCAGGGGAGCCCTGGGGCGGG + Intergenic
1061135610 9:128731646-128731668 ATCCACAGATGCCCTGGGACTGG - Intronic
1061616029 9:131779630-131779652 CTTCACAGGTGCCCTCAGTCTGG + Intergenic
1061789258 9:133050447-133050469 CCCCAAAAGTGCACTGAGTCAGG - Intronic
1061873106 9:133531123-133531145 CTCCAGAGATGCCCCGTGTCAGG - Intergenic
1185515323 X:695075-695097 CGCCAATGGTGCCCTGAGACAGG + Intergenic
1186781389 X:12915718-12915740 CTCCAGAGAAGCCCTGGGACAGG - Intronic
1188527296 X:31100031-31100053 CTCCAAAGATGCCCTGAGCCTGG + Intronic
1198079509 X:133225922-133225944 CTCCAGAGGTGGCCTGGATTTGG - Intergenic
1200058446 X:153473441-153473463 CTCCCCAGGTTCCCTGGTTCAGG - Intronic
1200142101 X:153907520-153907542 CTCCAAAAGGGGCCTGGGCCAGG + Exonic
1202275214 Y:23111092-23111114 CTCCAAAGAGGCCAGGGGTCTGG + Intergenic
1202290814 Y:23309599-23309621 CTCCAAAGAGGCCAGGGGTCTGG - Intergenic
1202428205 Y:24744811-24744833 CTCCAAAGAGGCCAGGGGTCTGG + Intergenic
1202442586 Y:24925278-24925300 CTCCAAAGAGGCCAGGGGTCTGG - Intergenic