ID: 994699179

View in Genome Browser
Species Human (GRCh38)
Location 5:103111823-103111845
Sequence TGGTCTCTCCAGGAGGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994699179 Original CRISPR TGGTCTCTCCAGGAGGTAAA TGG (reversed) Intronic
900761577 1:4475510-4475532 TTGTGTCTCCATGAGGGAAAAGG - Intergenic
901194746 1:7434050-7434072 GGGACTCTCCAGGAGGTGGAAGG - Intronic
902957928 1:19939323-19939345 TGTTCTCTCCATGAGGAAATAGG - Intergenic
903418149 1:23198842-23198864 TGGTTACTCCTGGAGGGAAAAGG + Intergenic
903477937 1:23633153-23633175 TGGTCTCTCAAGGGGGAACAGGG + Intronic
906258945 1:44371656-44371678 TGTTCCTTCCAGGATGTAAAGGG - Intergenic
906667498 1:47631997-47632019 TGGGCTCTCCAGGATGAGAAGGG + Intergenic
907241176 1:53081892-53081914 TGGCCTCTCCAGAAGGTAACAGG - Intronic
912458860 1:109818110-109818132 TGGGATCTTCTGGAGGTAAAAGG + Intergenic
914348626 1:146821010-146821032 TGGTCTCTGCAGGAGCTGAAGGG + Intergenic
917502525 1:175599010-175599032 CCGGCTCTCCAGGAGCTAAAGGG + Intronic
923019934 1:230155345-230155367 CGGTCTCTCCCGGAGGTCAGCGG - Intronic
1063710624 10:8474251-8474273 TGTTCTTTCCTGGAGGTAAAAGG + Intergenic
1064253115 10:13722047-13722069 TGCTCGCTCCAGGGGGTACAGGG + Intronic
1068868027 10:61915580-61915602 TGGTCCCTCCAGTGGGCAAACGG - Intronic
1069180438 10:65352024-65352046 TCGACTCTCCTGGAGGTAAGAGG - Intergenic
1070715694 10:78719490-78719512 TGGCCTCACCAGGATGTAAAAGG + Intergenic
1071329480 10:84545611-84545633 TGTACTCCCCAGGAGGGAAAAGG - Intergenic
1072610862 10:97017058-97017080 TGGGCTCTCCAGGTGGAAAGGGG - Intronic
1073075598 10:100824232-100824254 TGGTCTCTCCAGCAGCCAAATGG - Intronic
1073315371 10:102577028-102577050 TGGTCTCTTCAGGAAGAAGATGG + Intronic
1078396040 11:10982993-10983015 TGGATTCTCCAGGAGGTGATGGG + Intergenic
1079242228 11:18729128-18729150 TGGTCTCTCCAAGACGCACAGGG - Intronic
1079591053 11:22183056-22183078 TGGTTTCTCCAGTAGTTAGATGG + Intergenic
1080181451 11:29431125-29431147 TGGTCTCCCCAGGAAGAAACAGG - Intergenic
1080421687 11:32116629-32116651 TGATCTCACCAGGAGGTAATTGG + Intergenic
1080643260 11:34170516-34170538 TGGTATCTCCATGAGGACAAGGG + Intronic
1084638620 11:70410642-70410664 TCTTCTCTCCAGGAAGGAAAAGG - Intronic
1084939045 11:72602524-72602546 TGGTCCCCCCAGGAGGGAGAGGG - Intronic
1085214555 11:74817455-74817477 TGGTATCTCCAGGAGGCAGTTGG + Intronic
1089768369 11:120784979-120785001 AGGTCTCCCCTGGAGGTAACAGG + Intronic
1090617380 11:128527594-128527616 TGGACTCTTGAGGAGGTAGAGGG + Intronic
1095168152 12:38999303-38999325 TGTTAACTCCAGGAGGGAAAAGG + Intergenic
1095298659 12:40556802-40556824 TGGGCTCTCCAGGACCTAAAGGG + Intronic
1098587151 12:72167368-72167390 TGTTCTTTCCATGATGTAAAGGG - Intronic
1100210151 12:92391376-92391398 TGGACTATTCATGAGGTAAATGG + Intergenic
1100282383 12:93130257-93130279 TGAGCTCTCAAGGAGGCAAATGG - Intergenic
1100997217 12:100314895-100314917 TTGTCTCACCAGCAGTTAAAGGG + Intronic
1101246208 12:102886171-102886193 TGCTGTCTCCAGGAGGCAGAGGG - Intronic
1101546364 12:105717068-105717090 TGATCTCTCCAAAAGGAAAATGG - Intergenic
1102201370 12:111059921-111059943 TGGTCTTTCCAGCAGGTCCAGGG + Intronic
1103012630 12:117469021-117469043 TGAGCTCTCTAGAAGGTAAAAGG - Intronic
1104139230 12:125971697-125971719 TGGTCTCTCCAGGTGGAGTACGG - Intergenic
1107349764 13:39501702-39501724 TGCCCTCTCCATGGGGTAAATGG - Intronic
1109657833 13:65417490-65417512 TGGTTTCTGCATGAGGAAAAGGG + Intergenic
1109860610 13:68192995-68193017 GGGTCTCTCCATGAGGTTATAGG + Intergenic
1110953388 13:81522184-81522206 TTGTCTCACCAGCAGGAAAATGG - Intergenic
1112919326 13:104591775-104591797 TGGTCCCACCTGGAGATAAATGG - Intergenic
1117163359 14:53010660-53010682 GGCTCTCTCCAGGACTTAAAAGG + Intergenic
1120636237 14:86954822-86954844 TAGTGGCTCCAGGAGATAAAGGG - Intergenic
1121484730 14:94305909-94305931 TTGTCTCACCATGAGGTAAATGG - Intronic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1126535854 15:49763409-49763431 TGTTCTTTTCAGGAGCTAAAAGG - Intergenic
1129291138 15:74568713-74568735 TGATCTCTCCAGGAGCTCACAGG - Intronic
1129973789 15:79804056-79804078 TGGTCTCTCCAAGTGTAAAATGG + Intergenic
1134136823 16:11682194-11682216 TGGTTTAGCCAGAAGGTAAATGG - Intronic
1134816595 16:17210928-17210950 TGGCATCTCCAGCAGGTAACAGG + Intronic
1139985412 16:70894538-70894560 TGGTCTCTGCAGGAGCTGAAGGG - Exonic
1141195517 16:81857843-81857865 TGGTTTCTCCATGTGTTAAATGG + Intronic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1141526558 16:84615466-84615488 TGTTCTCTCCAGCAAGTAGAAGG - Intronic
1141980219 16:87545481-87545503 TGGTCTCACCATGAGATCAATGG + Intergenic
1143122593 17:4618180-4618202 TGGTGTCTCCAGGATAAAAATGG - Intergenic
1144159528 17:12543999-12544021 TGCTCTCTCCAGGAGGTGACAGG - Intergenic
1150030442 17:61728822-61728844 TGATATCTCCAGGAGAAAAAAGG + Intronic
1150207886 17:63422508-63422530 TGGTCTTCCTAGGGGGTAAAAGG + Exonic
1151101285 17:71558170-71558192 TGGTTTCACGAGGTGGTAAAAGG + Intergenic
1151436248 17:74099620-74099642 TGATCTCTGCAGGAGGGAAATGG - Intergenic
1151825722 17:76523198-76523220 TGGTCACCCCAGGAGGGTAATGG + Intergenic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1154000924 18:10481904-10481926 TGGTCACTTCAGGAGGTTGATGG - Intronic
1160515622 18:79477932-79477954 TGGTGTTTGCAGGAGGTAACTGG - Intronic
1161608680 19:5229156-5229178 TGGGCGCTCCAAGAGGTAATGGG + Intronic
1161846035 19:6712499-6712521 GGGTCTCACCATGAGGTCAAAGG + Exonic
1163300230 19:16440877-16440899 TGGCCGATCCAGAAGGTAAAGGG - Exonic
1163365047 19:16871184-16871206 TGCGCTCTCCAGGAGGCATATGG + Intronic
1165351750 19:35279519-35279541 TGGTCTCACCTGGAGGCAAGAGG + Exonic
1165418944 19:35713263-35713285 TGGTCTCTCCTGCAGGCAGAAGG + Intronic
1168313778 19:55474893-55474915 TGGTCTCTGCAGTAGTGAAAGGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925275682 2:2646481-2646503 TCTTGTCTCCAGGAGGTAACAGG + Intergenic
926737754 2:16086837-16086859 TAGTCTCTCCACGAGGAAACAGG + Intergenic
927455327 2:23243713-23243735 TGCTTTCTCCAGGTGGTCAAAGG - Intergenic
927811676 2:26184071-26184093 TGGTCTCTCCAGGATGAACGTGG + Intronic
931709347 2:64974699-64974721 GGGTGTCTCCAGGAAGTAGACGG - Intergenic
932983022 2:76693152-76693174 TGTTCTCTCCAAGAGTTAATGGG - Intergenic
933761933 2:85678587-85678609 TGGTCTCTCCCTGAAGTAAGAGG + Intergenic
934112572 2:88756871-88756893 TGGTCTCTTCAGGAGGCAAAGGG + Intergenic
934515009 2:94981021-94981043 TGGTCTCTTCAGGAGGTGATGGG - Intergenic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
935881585 2:107571013-107571035 TGCTCCTTCCTGGAGGTAAATGG + Intergenic
936163781 2:110103332-110103354 TGGTCTCTTCAGGAGGCAAAGGG + Intronic
942935762 2:181554754-181554776 GTCTCTCTCCAGGAGGCAAATGG + Intronic
943176766 2:184485889-184485911 TGGTGTCTCCAAAAAGTAAATGG - Intergenic
946805762 2:223469858-223469880 TGGTGTTCCCAGGAGATAAATGG - Intergenic
947948305 2:234125355-234125377 AGGTCTCTCCAGGAGGGACCTGG - Intergenic
1169666034 20:8037003-8037025 TGGTCACTCCCGGGGGTAAAAGG + Intergenic
1170723626 20:18905735-18905757 TGGGCTCTCTAGGATGCAAAAGG - Intergenic
1173681636 20:44886077-44886099 GAGCCTCTCCAAGAGGTAAAGGG - Intronic
1175462179 20:59159908-59159930 TGGTCTCTCCAGCAAGTTCAGGG + Intergenic
1179445109 21:41425660-41425682 TGGCCTCTCCAGGGTGGAAACGG - Intronic
1182983887 22:34698516-34698538 GGTGCTCTCCAGGAGCTAAAAGG - Intergenic
1183083107 22:35469786-35469808 TGGCTTCTCCAGGAGGTCAAGGG - Intergenic
1185241394 22:49749439-49749461 TGGTGTCCCCAGGAGGGGAAAGG - Intergenic
949392932 3:3582851-3582873 TAGTATCTCCAGGAGGTATCAGG - Intergenic
952589601 3:34934429-34934451 TGGTCTTTCAAGGTGCTAAAAGG + Intergenic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
954808293 3:53232731-53232753 TGTTCCCTCCAGGAGGTGAGTGG - Intronic
961869669 3:129978134-129978156 TAGTCTCCCCAGGAGTCAAATGG - Intergenic
966325807 3:178752506-178752528 TGGTCTATCTTGGAGGTAAATGG + Intronic
967844009 3:194030297-194030319 AGGTGTCTCCAGGATGTTAAAGG + Intergenic
968263569 3:197344359-197344381 TGGTCTGGCCAGGAGGTAATAGG - Intergenic
968400656 4:293374-293396 AGGTCTATCCAGGTTGTAAATGG - Intronic
972187788 4:36552524-36552546 TTCTCTATTCAGGAGGTAAAAGG + Intergenic
976698283 4:87941624-87941646 TGGTTTCTGCAGAAGATAAATGG + Intergenic
977008097 4:91597836-91597858 TGCTCTCTTCAGGAGGAATATGG + Intronic
978988382 4:115045638-115045660 TGGCCTCTCCAGAATGAAAAAGG - Intronic
979668570 4:123339099-123339121 TAGTCCATCCAGGAGGAAAAAGG + Intergenic
979807884 4:124997281-124997303 TGGTCTGTGCAGGAGTCAAAAGG - Intergenic
980462116 4:133127692-133127714 TGGTGTCTCCAATAGCTAAATGG - Intergenic
985925207 5:3010637-3010659 TCGTATTTCCAGGAGTTAAAGGG + Intergenic
990655392 5:57949532-57949554 TGGTCTGACCAGCTGGTAAAAGG + Intergenic
992327881 5:75681734-75681756 TGGTATTTCCAGTAGCTAAAAGG - Intronic
993060687 5:83035531-83035553 TGGTCTCTCCAGGAGACTACAGG - Intergenic
994403658 5:99316096-99316118 TTGTCACTCCAGGATGCAAAGGG - Intergenic
994699179 5:103111823-103111845 TGGTCTCTCCAGGAGGTAAATGG - Intronic
995145359 5:108782367-108782389 TGGTCTATGCAGGAGGTTGAAGG - Intronic
997200793 5:132009102-132009124 TGGCCTCTCCAGCAGGCAACAGG + Intronic
997877094 5:137559273-137559295 TGGTCTCTCCAGCCTGTAGATGG + Intronic
1006892389 6:37440153-37440175 GGAGCTCCCCAGGAGGTAAATGG + Intronic
1010149585 6:72715244-72715266 TGATCTCACCAGCAGGTACAGGG - Intronic
1010563033 6:77374196-77374218 TGGTTTCTGCAGGAAGAAAAGGG - Intergenic
1010648233 6:78420026-78420048 TGGTCTCTCCAAGAGAGAAAGGG - Intergenic
1014283208 6:119465048-119465070 TGATGTCTACAGGAGGTGAAGGG - Intergenic
1016844776 6:148559559-148559581 TGGTCACTCCAGCAGGTTTAAGG - Intergenic
1017830528 6:158124084-158124106 TGGGCTATCCAGGAGATAAGAGG + Intronic
1019028803 6:168992977-168992999 TCGTATTTCCAGGATGTAAAAGG + Intergenic
1021146325 7:17093514-17093536 TAGTCTCTGCAGGAGGAAGAAGG + Intergenic
1021988138 7:26117126-26117148 TGGGCTTCCCAGGAGGAAAAGGG + Intergenic
1022166642 7:27771560-27771582 TGTGCTCTCCAGGTGATAAAGGG + Intronic
1023884656 7:44345134-44345156 TGGTCTCTGGAGGAAGTTAATGG - Intergenic
1027576749 7:79940666-79940688 TAGTCTCTCCAGAAGGAAACCGG - Intergenic
1028720865 7:94029644-94029666 TGTTCTCTACAGAAGGCAAATGG - Intergenic
1035669127 8:1403122-1403144 TGATCACTCCAGGTGGTGAAGGG + Intergenic
1037695309 8:21218262-21218284 GGGGCTCTCCAGGAGGTCAGAGG - Intergenic
1038216352 8:25565029-25565051 TGGTCTTTCAAGGAGCTGAAGGG + Intergenic
1038615301 8:29088448-29088470 TGTTCTTACCAGGAAGTAAAGGG - Intronic
1040352370 8:46582161-46582183 TGGTAACTGCAGGGGGTAAAGGG - Intergenic
1042236104 8:66614158-66614180 TGGTCTCTCCAGAGGGAAGAAGG - Intronic
1043578553 8:81686300-81686322 TCGTCTCTTCCGGAGGTAGAGGG + Intronic
1044113952 8:88311249-88311271 TGATATATCCAGGAGGTAAAAGG + Intronic
1047024772 8:120812661-120812683 TGGGCTCCCCAGGAGTTAAAAGG + Intronic
1048791214 8:138105697-138105719 TGGTCTTTCCAGGAGGGCAATGG + Intergenic
1052956474 9:34256427-34256449 TGGGTTCTCCAGGAGGGACATGG + Exonic
1055039914 9:71858429-71858451 TGGTCTTCCCAGGAGAAAAAAGG - Intergenic
1055064239 9:72102529-72102551 TGGTCTCTCCAGCATATAATTGG - Intergenic
1056022095 9:82449042-82449064 TGGTCTGTCTCGGAGGTAACAGG - Intergenic
1056878930 9:90369635-90369657 TGTTCTCTCCAGGAGAGCAATGG + Intergenic
1056963954 9:91150670-91150692 TAGTCTCTCCAGCAGGTCGATGG - Intergenic
1057048583 9:91904511-91904533 TGGTCTCTCCAGGCTGTGACTGG - Intronic
1057962441 9:99469613-99469635 TGTTCCCTCCAGCAGGGAAAGGG + Intergenic
1061078481 9:128355840-128355862 GGGTCTCTCCAGAAGGAAACGGG - Intronic
1062699832 9:137893049-137893071 GGCTCTCTCCAGGAGGGCAAAGG + Intronic
1186822977 X:13310695-13310717 AGGTCTCTCCAGGAGATTCAGGG + Intergenic
1187001810 X:15188360-15188382 TGGTTTCTTCAGCAGGTCAATGG + Intergenic
1187386594 X:18854407-18854429 TGATCTTTCCAGGAGTGAAAAGG - Intergenic
1187851804 X:23598452-23598474 AGCTCTCTTCTGGAGGTAAATGG + Intergenic
1189222234 X:39382404-39382426 TGGTCTGGCCAGGAGATAAAAGG + Intergenic
1189634004 X:42985663-42985685 TGAGCTCTGCAGGAGGTAATGGG + Intergenic
1190161180 X:48032547-48032569 TGCACTCTCCAGGAGGCAGAAGG - Intronic
1190448473 X:50554631-50554653 TGCACACTCCAGGAGGTAAATGG - Intergenic
1194138646 X:90179743-90179765 TTGTTCGTCCAGGAGGTAAAAGG + Intergenic
1195084673 X:101402934-101402956 TGAACTCTCTAGGAGGAAAAAGG - Intronic
1197621407 X:128754187-128754209 GGGTTTCACCAGGAGTTAAAAGG + Intergenic
1198112149 X:133511053-133511075 TGGCCTCTCTAGCAGGGAAATGG + Intergenic
1198270378 X:135051440-135051462 TGGTCTGTCCAGTATGTAACAGG + Exonic
1199541392 X:148961222-148961244 TGGCATCTACAGGAGGTGAATGG - Intronic
1200484448 Y:3749978-3750000 TTGTTCGTCCAGGAGGTAAAAGG + Intergenic