ID: 994703352

View in Genome Browser
Species Human (GRCh38)
Location 5:103166290-103166312
Sequence CTCTGTAGTGAAGATTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994703352_994703358 22 Left 994703352 5:103166290-103166312 CCCACAAAATCTTCACTACAGAG 0: 1
1: 0
2: 1
3: 19
4: 198
Right 994703358 5:103166335-103166357 TGCTTATTCCTCTCAGACAAGGG 0: 1
1: 0
2: 1
3: 17
4: 200
994703352_994703357 21 Left 994703352 5:103166290-103166312 CCCACAAAATCTTCACTACAGAG 0: 1
1: 0
2: 1
3: 19
4: 198
Right 994703357 5:103166334-103166356 CTGCTTATTCCTCTCAGACAAGG 0: 1
1: 0
2: 2
3: 19
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994703352 Original CRISPR CTCTGTAGTGAAGATTTTGT GGG (reversed) Intronic
900732038 1:4268446-4268468 GTCTGTGGTGAAGAATTTGTAGG + Intergenic
903082434 1:20821094-20821116 CTCTGGAGTGTCGATTTTTTTGG - Intronic
906585217 1:46969908-46969930 CTATGTAGTGAAAATTTTGTTGG + Intergenic
909351158 1:74654972-74654994 CTCTGTAGTGGAGAATTGGGTGG - Intronic
909875415 1:80796869-80796891 CTCTGTAGTGCAGATGTTCAGGG - Intergenic
910716639 1:90238130-90238152 CTCTGTATTGTACATTTTATGGG + Intergenic
913437211 1:118859568-118859590 TTCTGCAGGGAGGATTTTGTAGG - Intergenic
914506474 1:148294062-148294084 CTCTGTACTGAAGGTTTCCTAGG - Intergenic
914859387 1:151373730-151373752 CTCTGGGGTGAAGTTTTTATTGG + Intergenic
915377660 1:155411779-155411801 CTCTGGAGTGAGGGTTTTCTTGG - Intronic
917186885 1:172367247-172367269 TTCTGAAGTATAGATTTTGTAGG - Intronic
918851845 1:189701807-189701829 CTATGTAGTGGTGATTGTGTGGG - Intergenic
921232598 1:213088215-213088237 CTCTGTAGAGAAGGTGTGGTTGG - Intronic
922180678 1:223230670-223230692 CACTGTAGTGTAGATCTTGTTGG + Intronic
922527450 1:226316487-226316509 CTCCCTAGTGAAGATTTCTTAGG - Intergenic
1064421278 10:15192932-15192954 CTCTGTAGGAAAGATTTGGAGGG + Intergenic
1067718821 10:48711004-48711026 CTCTGCTTTGAATATTTTGTAGG - Intronic
1071760002 10:88592576-88592598 CTCTGTAGTGTAATTTTTATGGG - Intronic
1072496438 10:95965016-95965038 CTCTGTAGTTAACATTTTTGAGG + Intronic
1072593570 10:96849895-96849917 CTCTGACGTGAAGATATTGTTGG + Intronic
1074770690 10:116731663-116731685 CTGTGTAGTAAAGAATTTCTAGG - Intronic
1077412605 11:2410610-2410632 CTCTGTAGTGATGGGTTGGTGGG - Intronic
1077871295 11:6263945-6263967 CTCTGTAGATAACATTTTGTAGG - Intronic
1078842727 11:15093579-15093601 CTTTGTGGTGAAGCTCTTGTGGG + Intergenic
1079351788 11:19698005-19698027 CAGTGTAGTGAAGATTCTGGTGG - Intronic
1080200239 11:29660441-29660463 CTCTCTAATGAAGTTTTTCTGGG + Intergenic
1080205881 11:29728184-29728206 CTGTCTAGTAAATATTTTGTTGG + Intergenic
1080245568 11:30176095-30176117 CTCTGATGTGAGAATTTTGTTGG - Intergenic
1083111787 11:60417190-60417212 CTCTGGATTGAAGGTCTTGTTGG - Exonic
1084604875 11:70166570-70166592 CTCTGGAGTCAAGAACTTGTCGG + Intronic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1084923235 11:72489793-72489815 ATTTGAAGTGAAGTTTTTGTAGG - Intergenic
1085894668 11:80624301-80624323 CTCTAGACAGAAGATTTTGTTGG + Intergenic
1087591329 11:100192304-100192326 CACTGTAGTTTAAATTTTGTGGG - Intronic
1089904592 11:122025529-122025551 CTCTGTTGGGTAGATTTTGTTGG - Intergenic
1090696613 11:129250307-129250329 AACTGCTGTGAAGATTTTGTTGG + Intronic
1090887557 11:130892750-130892772 CTCTGCAGTGAAAGTTTTATTGG - Intronic
1090930868 11:131297088-131297110 GGCTGTAGGGAAGATATTGTGGG + Intergenic
1091950460 12:4588645-4588667 GTCTCTAGTTAAGATTTTGTTGG + Intronic
1093809127 12:23471415-23471437 AACTGTAGTGAAGAAATTGTTGG + Intergenic
1098470770 12:70840849-70840871 CCCTGTTGTGATAATTTTGTTGG - Intronic
1099315887 12:81081842-81081864 TTCTGTAGTCAAGATACTGTGGG + Intronic
1102288672 12:111680972-111680994 CTCTTCAGTAAAGATTTGGTGGG + Intronic
1107550621 13:41471331-41471353 CTCTGGTGTGAAGAGTTTGACGG + Intergenic
1107629157 13:42325785-42325807 CCGTGGAGTGAAGATTTTGTTGG + Intergenic
1108438248 13:50422567-50422589 CTCTGCAGGGAACATTCTGTGGG + Intronic
1109947470 13:69456000-69456022 CTCTCTGGTGAAGATTTCTTGGG + Intergenic
1110024825 13:70523352-70523374 CTCTCTGGTGAAGATTTCCTGGG + Intergenic
1110476549 13:75921698-75921720 CTCTATACTGAAGAATTTATTGG + Intergenic
1110692897 13:78452631-78452653 CTTTGTAGTGATGATTTCATGGG - Intergenic
1111415390 13:87935068-87935090 CTGTGTAATAAAGATTTTGAAGG - Intergenic
1113184047 13:107666131-107666153 CTCTGTGGTGAAGTTTTTCTGGG + Intronic
1115447229 14:33505179-33505201 CTCTATAGTCAATATTTTGCTGG - Intronic
1115823097 14:37233745-37233767 CTCTCTGGTGAAGCTTTTCTAGG + Intronic
1117152500 14:52903873-52903895 CTCTGGGGTGAATATTTTCTTGG - Intronic
1118451845 14:65910137-65910159 CTCTTTAGTAAAGAGTTTGGAGG + Intergenic
1118998263 14:70857464-70857486 CTCTGGATTCAAAATTTTGTAGG - Intergenic
1121493983 14:94379406-94379428 ATCTGTAGGGAAGAATGTGTGGG - Intronic
1123448572 15:20346269-20346291 CTCTGGAGTTATGAATTTGTGGG + Intergenic
1124075855 15:26443623-26443645 CTCTGTAGGGAGGATTTGGGAGG - Intergenic
1125361254 15:38866903-38866925 CTCTCTAGTGTAGATGCTGTAGG - Intergenic
1126898508 15:53286300-53286322 CTCTGTAGTGAAGATGGACTTGG - Intergenic
1126990091 15:54364611-54364633 CACTGTAGTGACTTTTTTGTTGG + Intronic
1128243559 15:66117858-66117880 TTCGGTAGTGATGGTTTTGTAGG - Intronic
1130413096 15:83663791-83663813 CTCTGTATTGCAGATTTTCAGGG - Intronic
1131028262 15:89163776-89163798 CACTGTTGTGAATACTTTGTAGG + Intronic
1133713213 16:8421533-8421555 CCCTTTAGGGTAGATTTTGTAGG + Intergenic
1137260360 16:46822751-46822773 CTGTGTAGAGAATAGTTTGTAGG - Intronic
1140279614 16:73542901-73542923 CTCTGTTGTGTAAATTTTGGGGG + Intergenic
1141062782 16:80889803-80889825 TTCTGTGGTGTACATTTTGTGGG - Intergenic
1141325248 16:83050969-83050991 CACTGTAATGAAGAGTTTGCAGG - Intronic
1145187952 17:20812238-20812260 CTCTGGAGAGAAAATTTTCTGGG + Intergenic
1150078980 17:62219494-62219516 CTCTGGAGAGAAAATTTTCTGGG - Intergenic
1150928234 17:69556646-69556668 CTGTTTACTCAAGATTTTGTAGG + Intergenic
1151141799 17:72000295-72000317 CTCTCTAGTGAAAATTTGGCTGG + Intergenic
1152340216 17:79720319-79720341 CTCTGGAGTTATGAATTTGTGGG - Intergenic
1152980193 18:268988-269010 CTCAGTTGTTAAGATTTTGCTGG - Intergenic
1153386939 18:4509682-4509704 CTCAGTAGTTAAGATTTTCTAGG - Intergenic
1153487190 18:5611603-5611625 CTCTCTAATGAAGCTTTTCTTGG - Intronic
1155601652 18:27555793-27555815 CTCTCTGGTGAAGATTTCCTGGG - Intergenic
1155984546 18:32216218-32216240 CACTGGAGTCAAAATTTTGTGGG - Intronic
1157164440 18:45345465-45345487 CTTTGTAGGGAAGCTTTTGCAGG - Intronic
1157598293 18:48877028-48877050 ATTTGTAGTGATGATTTCGTGGG + Intergenic
1158174426 18:54638378-54638400 CTTGGTAGTGAAGCTTTAGTTGG - Intergenic
1158850140 18:61487724-61487746 ATCTGTGATGAATATTTTGTAGG - Intronic
1159813608 18:73046325-73046347 TTCTGTTTTCAAGATTTTGTTGG + Intergenic
1160125899 18:76171187-76171209 CTCTGCAGTGAAGAATATGGAGG - Intergenic
1166970488 19:46563885-46563907 CTCTTTAGTGAAGAAATTGGAGG + Intronic
1167833887 19:52050375-52050397 CTTAGTAGTGAACATTCTGTGGG + Intronic
1168692008 19:58382975-58382997 CTCTGGAGTGAAGATTCTGGTGG + Intergenic
926381821 2:12298575-12298597 CTCTAGAGTGATGTTTTTGTTGG + Intergenic
928336231 2:30400801-30400823 CTCTCTTGTGAAGGCTTTGTGGG - Intergenic
929843334 2:45495089-45495111 CTCTGTAGCTAAGATTTGATAGG - Intronic
933082444 2:78007909-78007931 CCCTTAAGTGATGATTTTGTTGG - Intergenic
933396410 2:81737266-81737288 CTCTGTAGTCTAAATTTTTTTGG + Intergenic
933729030 2:85443374-85443396 GTCTGCAGTGAACATTTTGGGGG + Intergenic
935281727 2:101523570-101523592 CTCTCTAGTGAAGCTTTCCTGGG + Intergenic
936595050 2:113839729-113839751 CTCTGTTGTGATTATTTTGTTGG - Intergenic
939984828 2:148819562-148819584 CTCTGTAGTGGAGATTTTCCAGG - Intergenic
940298550 2:152155375-152155397 CTCAGCAGTGAAGCTTTGGTTGG - Intronic
941129937 2:161635318-161635340 CTCTCTGGTGAAGGTTTTCTGGG + Intronic
942367859 2:175247581-175247603 CTCTTTGGTGAAGATTTTTCTGG - Intergenic
942785168 2:179692752-179692774 CTCATTGGTGAAGATTTTGCAGG + Intronic
943357491 2:186875356-186875378 CTCTCTGGTGAAGATTTCCTGGG + Intergenic
945155807 2:206835847-206835869 TTCTGTAGTGGACATTGTGTTGG - Intergenic
945760660 2:213910337-213910359 CTTTTTACTGAAGATTTTCTAGG + Intronic
946526710 2:220528890-220528912 CTGTGTAGTGTTGATATTGTTGG + Intergenic
947390282 2:229632011-229632033 TTCTGTAGTGCAGAGTTTATTGG - Intronic
948838672 2:240638352-240638374 CTCTGTGGTGATGAGTGTGTGGG - Intergenic
1169033902 20:2434148-2434170 CTCTCTGGTGAAGCTTTTCTGGG - Intergenic
1169384375 20:5135787-5135809 GTCTGTGGTGCAGAATTTGTAGG + Intronic
1170398660 20:15956495-15956517 CTCTGTAGTGGAAAATCTGTGGG + Intronic
1170661852 20:18349541-18349563 CCCTCAAGTGAAGAATTTGTGGG + Intergenic
1172823867 20:37763284-37763306 TTCTTTAGTGAAGCTTTTGCTGG + Intronic
1174192769 20:48751884-48751906 CTGGGTAGTGATGAGTTTGTGGG - Intronic
1177707098 21:24720539-24720561 CTCTGGAGCTAAGATTGTGTAGG + Intergenic
1178703688 21:34855292-34855314 CTCTGTAGAGAAGATGCTTTGGG + Intronic
1182834387 22:33330021-33330043 CTCTGGAGTCTAGGTTTTGTTGG - Intronic
953808784 3:46094438-46094460 CTCTGGAGTGAAGATTTAAAAGG + Intergenic
953858832 3:46524497-46524519 CTCTGTCCTGAAGATGTTGGTGG - Intronic
954867839 3:53744752-53744774 CTCCGTTGTGAAGATTCTGAGGG + Exonic
955100912 3:55848880-55848902 CACTGTAGTGAAGAAGATGTGGG - Intronic
956923619 3:73957891-73957913 CTCTCTGGTGAAGCTTTTCTGGG - Intergenic
957605270 3:82390617-82390639 CTCTTTCTTGAAGATTTTGCAGG - Intergenic
959147833 3:102571115-102571137 CTCTGTAGTTTAGATTTATTTGG - Intergenic
962167621 3:133066156-133066178 CTCTATAGTAAAGACTTTCTTGG + Intronic
963028147 3:140940778-140940800 CTCTCTGGTGAAGATTTCGTAGG - Intergenic
963970700 3:151426369-151426391 CTCAGTAGTGAGGCTTCTGTAGG + Intronic
965467416 3:169047589-169047611 ATCTGTAGTGAACATTATTTTGG - Intergenic
967679470 3:192343374-192343396 CTTTTTATTTAAGATTTTGTAGG - Intronic
968862479 4:3183974-3183996 TCTTGGAGTGAAGATTTTGTTGG + Intronic
969233474 4:5848505-5848527 CTGTGGAGTGGAGAATTTGTTGG - Intronic
971207138 4:24581808-24581830 TTGTATAGTGAAGATTCTGTGGG + Intronic
973238841 4:47935072-47935094 TTCTGTAGTGAAGATATTGAAGG + Intronic
973729849 4:53812549-53812571 ATCTTTAGTGGACATTTTGTGGG + Intronic
974575999 4:63722767-63722789 CTCTCTAGTGAAGCTTTCCTGGG - Intergenic
974977491 4:68907902-68907924 CACTGTATTTAATATTTTGTGGG + Intergenic
975356018 4:73405538-73405560 CTATGTAAAGAAGATTTAGTGGG - Intronic
977439925 4:97052058-97052080 CTCTTTACTGTTGATTTTGTTGG + Intergenic
978339043 4:107702265-107702287 CTCTGTATTGAACATTTTGAGGG - Intronic
978518159 4:109591498-109591520 TTCTGTTGTGTAGACTTTGTTGG + Intronic
982666252 4:158268269-158268291 CTCTGTATTGAAGATCTAATTGG - Intergenic
983107174 4:163701728-163701750 TTCTGTAGAGAAAATGTTGTTGG + Intronic
983188770 4:164731909-164731931 CTCTGAAGGGAAGACTTTTTAGG - Intergenic
983367550 4:166814098-166814120 CTCTCTAGTGAAGATTTTCAGGG - Intronic
983444890 4:167837244-167837266 CTGTGAATTGAAGATATTGTAGG - Intergenic
984232673 4:177117799-177117821 TCCTGTAGTGTAGATTTTTTTGG - Intergenic
985899277 5:2775460-2775482 CTCTCTGGAGAACATTTTGTAGG + Intergenic
985962225 5:3311355-3311377 GTCTGTAGTGAAGGTAATGTGGG + Intergenic
987497452 5:18665967-18665989 CTCTCTAGTGAAGCTTTTTCAGG - Intergenic
988808151 5:34759643-34759665 CACTGTAGTGTAGAATCTGTGGG - Intronic
988828017 5:34959505-34959527 CTCTGTGGTTAAGATTTCTTAGG + Intergenic
991380627 5:66020491-66020513 TTCTGTATTAAGGATTTTGTAGG - Intronic
991498057 5:67247470-67247492 CTCTGTAGTGTGAATTATGTGGG - Intergenic
992727454 5:79622953-79622975 CTCAGTAGTGAAAACTTTGTAGG - Intronic
992992994 5:82304465-82304487 CTTTGTATTGTACATTTTGTGGG + Intronic
993719574 5:91309085-91309107 CTCTGTCAAGAAGATATTGTCGG - Intergenic
993811071 5:92476669-92476691 CTCTGTACTCAAGAATTTGAGGG - Intergenic
994511979 5:100715684-100715706 CTCTTTGGTTAAGATTGTGTTGG + Intergenic
994703352 5:103166290-103166312 CTCTGTAGTGAAGATTTTGTGGG - Intronic
994792513 5:104248049-104248071 CTCTGTAGAGAATAGCTTGTAGG + Intergenic
998042224 5:138958440-138958462 CTCTGAAATTAATATTTTGTGGG + Intronic
999641572 5:153678352-153678374 TTCTGTAGAGAAGAATATGTAGG + Intronic
1000494112 5:161956804-161956826 TTCTCTGGTGAAGATTTTCTGGG - Intergenic
1000878111 5:166665613-166665635 TTCTGAAGTGATGATTTTATTGG + Intergenic
1004846810 6:19652388-19652410 CGCTGTTGTGAGGATATTGTGGG - Intergenic
1005528293 6:26674515-26674537 CTCTATAGTTCAGATTATGTAGG - Intergenic
1005542502 6:26827124-26827146 CTCTATAGTTCAGATTATGTAGG + Intergenic
1006064103 6:31449507-31449529 CTCAGGAGTGCAGATTTTGGGGG - Intergenic
1006111726 6:31750871-31750893 CTATGTAGAAAAGAATTTGTGGG + Intronic
1009013312 6:57869242-57869264 CTCTATAGTTCAGATTATGTAGG + Intergenic
1009041600 6:58186184-58186206 CTGTGTAGAGACGAGTTTGTAGG + Intergenic
1009217452 6:60940501-60940523 CTGTGTAGAGACGAGTTTGTAGG + Intergenic
1009405791 6:63310883-63310905 CTCTCTAGTGAAGGTTTCCTGGG + Intronic
1010299980 6:74248460-74248482 ATCTATACTAAAGATTTTGTGGG + Intergenic
1010495104 6:76524763-76524785 CTCTGTAGTGTAGTGTTTATTGG + Intergenic
1010873711 6:81074369-81074391 CTATGTAGTAAAGGTTTTCTGGG - Intergenic
1011364407 6:86565478-86565500 ATCTGTAGTGGAGTTTTTTTTGG + Intergenic
1011523474 6:88237404-88237426 CTCTGTAATGCAGCTTTTGTGGG + Intergenic
1014323015 6:119955393-119955415 CTCTGAAGTCAATATTTTCTTGG + Intergenic
1018873697 6:167802435-167802457 CTCTGTTGTGAAGAATCAGTGGG + Intergenic
1020542582 7:9477680-9477702 CTCTGTCTTGAGGATTTAGTAGG - Intergenic
1021068716 7:16210274-16210296 CACTGGAGTGCAGATATTGTAGG - Intronic
1021633946 7:22672957-22672979 CTCTGCATTGTAAATTTTGTTGG - Intergenic
1022887858 7:34664810-34664832 CTCTGCTGTGAAGATTTTCCAGG + Intronic
1024798084 7:53042431-53042453 CTCTCTGGTGAAGCTTTTCTGGG - Intergenic
1026014010 7:66658600-66658622 CTGTGTTGGGAAGATTTTATTGG - Intronic
1026518709 7:71096017-71096039 CTCTGTAGTTAAGATATAGAAGG + Intergenic
1028094006 7:86738019-86738041 CTCTGTTGGGGACATTTTGTAGG + Intronic
1029382315 7:100222000-100222022 CTCTGGATGGAACATTTTGTGGG - Intronic
1030783196 7:113627074-113627096 CACTGTAGGGAAGATTCTGAAGG + Intergenic
1032459235 7:132097312-132097334 CTGTAAAGTGAAGATTTTTTTGG - Intergenic
1034822441 7:154229053-154229075 CTCTGTGGTGAAGGTTTCTTGGG + Intronic
1035047555 7:155978963-155978985 CTCTGTAGGGATAAGTTTGTGGG + Intergenic
1037088784 8:14886672-14886694 CCCAGGAGGGAAGATTTTGTAGG + Intronic
1039517756 8:38147667-38147689 CTCTGTTATGGAGATTTTGGTGG - Intronic
1040843359 8:51808271-51808293 CTCTATAATAAATATTTTGTGGG - Intronic
1041867292 8:62590500-62590522 CTCTATAGTGAAAATTGTGCTGG - Intronic
1042499572 8:69493095-69493117 TTCTCTAGAGAAGATTTTGAAGG + Intronic
1042559332 8:70061204-70061226 CTCTGCAGGGATGCTTTTGTAGG - Intronic
1042925514 8:73964190-73964212 CTCTGTAGTTTATATTTTGGTGG + Intronic
1044212266 8:89563463-89563485 CTCTGTAGAGAAGCTTGTGAGGG + Intergenic
1044427543 8:92070648-92070670 CTTTGCAGGGAAGATTTTGGTGG - Intronic
1045381056 8:101626674-101626696 CTCTATAGTGAACATTTAGATGG + Intronic
1045830523 8:106454597-106454619 CTCTGAAATGAAGATGCTGTTGG - Intronic
1049984390 9:934921-934943 CTCTCTGGTGAATATTTTCTCGG + Intronic
1055079420 9:72254359-72254381 CTCTGTAGCAAAAACTTTGTTGG + Intronic
1056361189 9:85859338-85859360 AACTGTAGTGAAGATATTTTGGG - Intergenic
1057640850 9:96819681-96819703 CTCTGTAGTCAATAATTTATTGG + Exonic
1058281102 9:103115643-103115665 CTATGCAGTGAAGACTATGTGGG + Intergenic
1186316634 X:8377882-8377904 CTCTGTGCTGAATATTTTGGTGG + Intergenic
1188120235 X:26297103-26297125 CTCTGTAGTGAAGCTTTCCTGGG - Intergenic
1188595023 X:31889517-31889539 TTATTTAGTGAAGAGTTTGTGGG - Intronic
1188957614 X:36452283-36452305 CTCTGCAGTGAACAGTTTGGAGG + Intergenic
1195546696 X:106120022-106120044 CGCTATAGTAAAGATTTTTTAGG + Intergenic
1195739557 X:108049863-108049885 TTCTCCAGTGAAGTTTTTGTTGG + Intronic
1199107921 X:143893676-143893698 CTCAGTGCTGAAGATTTTTTTGG - Intergenic
1200496032 Y:3885366-3885388 TTCTGTAGTGAATCTTTAGTTGG - Intergenic
1202191668 Y:22252332-22252354 CTCTGTAGGGGAGTGTTTGTTGG + Intergenic