ID: 994707427

View in Genome Browser
Species Human (GRCh38)
Location 5:103223435-103223457
Sequence TTATCAGCAGAACGCCGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994707427_994707428 3 Left 994707427 5:103223435-103223457 CCACGTCGGCGTTCTGCTGATAA No data
Right 994707428 5:103223461-103223483 GTGAAGCCCTAGTATGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994707427 Original CRISPR TTATCAGCAGAACGCCGACG TGG (reversed) Intergenic
No off target data available for this crispr