ID: 994710055

View in Genome Browser
Species Human (GRCh38)
Location 5:103255870-103255892
Sequence GAACCATAGGTGGCAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994710051_994710055 14 Left 994710051 5:103255833-103255855 CCGTCTCGTCTATAGGCAGGTTG No data
Right 994710055 5:103255870-103255892 GAACCATAGGTGGCAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994710055 Original CRISPR GAACCATAGGTGGCAGCTCC AGG Intergenic
No off target data available for this crispr