ID: 994710099

View in Genome Browser
Species Human (GRCh38)
Location 5:103256157-103256179
Sequence AAGTCTGATACACCTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994710099_994710107 10 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710107 5:103256190-103256212 AGGCACTGGAAGGAGATTGGAGG No data
994710099_994710102 -10 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710102 5:103256170-103256192 TATCAGACTTGGCCAATGCAAGG No data
994710099_994710106 7 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data
994710099_994710104 0 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710104 5:103256180-103256202 GGCCAATGCAAGGCACTGGAAGG No data
994710099_994710103 -4 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data
994710099_994710109 15 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710109 5:103256195-103256217 CTGGAAGGAGATTGGAGGGCAGG No data
994710099_994710108 11 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710108 5:103256191-103256213 GGCACTGGAAGGAGATTGGAGGG No data
994710099_994710110 20 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710110 5:103256200-103256222 AGGAGATTGGAGGGCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994710099 Original CRISPR AAGTCTGATACACCTGCCAT GGG (reversed) Intergenic