ID: 994710100

View in Genome Browser
Species Human (GRCh38)
Location 5:103256158-103256180
Sequence CAAGTCTGATACACCTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994710100_994710106 6 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data
994710100_994710104 -1 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710104 5:103256180-103256202 GGCCAATGCAAGGCACTGGAAGG No data
994710100_994710107 9 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710107 5:103256190-103256212 AGGCACTGGAAGGAGATTGGAGG No data
994710100_994710109 14 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710109 5:103256195-103256217 CTGGAAGGAGATTGGAGGGCAGG No data
994710100_994710108 10 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710108 5:103256191-103256213 GGCACTGGAAGGAGATTGGAGGG No data
994710100_994710110 19 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710110 5:103256200-103256222 AGGAGATTGGAGGGCAGGAGAGG No data
994710100_994710103 -5 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994710100 Original CRISPR CAAGTCTGATACACCTGCCA TGG (reversed) Intergenic
No off target data available for this crispr