ID: 994710103

View in Genome Browser
Species Human (GRCh38)
Location 5:103256176-103256198
Sequence ACTTGGCCAATGCAAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994710094_994710103 17 Left 994710094 5:103256136-103256158 CCGTAGGCTGTTTCCCTGGCTCC No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data
994710099_994710103 -4 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data
994710098_994710103 3 Left 994710098 5:103256150-103256172 CCTGGCTCCCATGGCAGGTGTAT No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data
994710100_994710103 -5 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data
994710092_994710103 19 Left 994710092 5:103256134-103256156 CCCCGTAGGCTGTTTCCCTGGCT No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data
994710093_994710103 18 Left 994710093 5:103256135-103256157 CCCGTAGGCTGTTTCCCTGGCTC No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data
994710097_994710103 4 Left 994710097 5:103256149-103256171 CCCTGGCTCCCATGGCAGGTGTA No data
Right 994710103 5:103256176-103256198 ACTTGGCCAATGCAAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994710103 Original CRISPR ACTTGGCCAATGCAAGGCAC TGG Intergenic