ID: 994710105

View in Genome Browser
Species Human (GRCh38)
Location 5:103256182-103256204
Sequence CTCCTTCCAGTGCCTTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994710105_994710109 -10 Left 994710105 5:103256182-103256204 CCAATGCAAGGCACTGGAAGGAG No data
Right 994710109 5:103256195-103256217 CTGGAAGGAGATTGGAGGGCAGG No data
994710105_994710110 -5 Left 994710105 5:103256182-103256204 CCAATGCAAGGCACTGGAAGGAG No data
Right 994710110 5:103256200-103256222 AGGAGATTGGAGGGCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994710105 Original CRISPR CTCCTTCCAGTGCCTTGCAT TGG (reversed) Intergenic
No off target data available for this crispr