ID: 994710105 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:103256182-103256204 |
| Sequence | CTCCTTCCAGTGCCTTGCAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994710105_994710110 | -5 | Left | 994710105 | 5:103256182-103256204 | CCAATGCAAGGCACTGGAAGGAG | No data | ||
| Right | 994710110 | 5:103256200-103256222 | AGGAGATTGGAGGGCAGGAGAGG | No data | ||||
| 994710105_994710109 | -10 | Left | 994710105 | 5:103256182-103256204 | CCAATGCAAGGCACTGGAAGGAG | No data | ||
| Right | 994710109 | 5:103256195-103256217 | CTGGAAGGAGATTGGAGGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994710105 | Original CRISPR | CTCCTTCCAGTGCCTTGCAT TGG (reversed) | Intergenic | ||