ID: 994710106

View in Genome Browser
Species Human (GRCh38)
Location 5:103256187-103256209
Sequence GCAAGGCACTGGAAGGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994710092_994710106 30 Left 994710092 5:103256134-103256156 CCCCGTAGGCTGTTTCCCTGGCT No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data
994710097_994710106 15 Left 994710097 5:103256149-103256171 CCCTGGCTCCCATGGCAGGTGTA No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data
994710098_994710106 14 Left 994710098 5:103256150-103256172 CCTGGCTCCCATGGCAGGTGTAT No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data
994710099_994710106 7 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data
994710100_994710106 6 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data
994710094_994710106 28 Left 994710094 5:103256136-103256158 CCGTAGGCTGTTTCCCTGGCTCC No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data
994710093_994710106 29 Left 994710093 5:103256135-103256157 CCCGTAGGCTGTTTCCCTGGCTC No data
Right 994710106 5:103256187-103256209 GCAAGGCACTGGAAGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994710106 Original CRISPR GCAAGGCACTGGAAGGAGAT TGG Intergenic