ID: 994710107

View in Genome Browser
Species Human (GRCh38)
Location 5:103256190-103256212
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994710098_994710107 17 Left 994710098 5:103256150-103256172 CCTGGCTCCCATGGCAGGTGTAT No data
Right 994710107 5:103256190-103256212 AGGCACTGGAAGGAGATTGGAGG No data
994710099_994710107 10 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710107 5:103256190-103256212 AGGCACTGGAAGGAGATTGGAGG No data
994710100_994710107 9 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710107 5:103256190-103256212 AGGCACTGGAAGGAGATTGGAGG No data
994710097_994710107 18 Left 994710097 5:103256149-103256171 CCCTGGCTCCCATGGCAGGTGTA No data
Right 994710107 5:103256190-103256212 AGGCACTGGAAGGAGATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type