ID: 994710110

View in Genome Browser
Species Human (GRCh38)
Location 5:103256200-103256222
Sequence AGGAGATTGGAGGGCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994710097_994710110 28 Left 994710097 5:103256149-103256171 CCCTGGCTCCCATGGCAGGTGTA No data
Right 994710110 5:103256200-103256222 AGGAGATTGGAGGGCAGGAGAGG No data
994710100_994710110 19 Left 994710100 5:103256158-103256180 CCATGGCAGGTGTATCAGACTTG No data
Right 994710110 5:103256200-103256222 AGGAGATTGGAGGGCAGGAGAGG No data
994710105_994710110 -5 Left 994710105 5:103256182-103256204 CCAATGCAAGGCACTGGAAGGAG No data
Right 994710110 5:103256200-103256222 AGGAGATTGGAGGGCAGGAGAGG No data
994710099_994710110 20 Left 994710099 5:103256157-103256179 CCCATGGCAGGTGTATCAGACTT No data
Right 994710110 5:103256200-103256222 AGGAGATTGGAGGGCAGGAGAGG No data
994710098_994710110 27 Left 994710098 5:103256150-103256172 CCTGGCTCCCATGGCAGGTGTAT No data
Right 994710110 5:103256200-103256222 AGGAGATTGGAGGGCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994710110 Original CRISPR AGGAGATTGGAGGGCAGGAG AGG Intergenic
No off target data available for this crispr