ID: 994715398

View in Genome Browser
Species Human (GRCh38)
Location 5:103315549-103315571
Sequence CAGAAAGTAGAGAAGTAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994715391_994715398 25 Left 994715391 5:103315501-103315523 CCCCTTAGAAAATCCTCTATTTA No data
Right 994715398 5:103315549-103315571 CAGAAAGTAGAGAAGTAGTAAGG No data
994715394_994715398 12 Left 994715394 5:103315514-103315536 CCTCTATTTAATGACTTTGAAGG No data
Right 994715398 5:103315549-103315571 CAGAAAGTAGAGAAGTAGTAAGG No data
994715392_994715398 24 Left 994715392 5:103315502-103315524 CCCTTAGAAAATCCTCTATTTAA No data
Right 994715398 5:103315549-103315571 CAGAAAGTAGAGAAGTAGTAAGG No data
994715393_994715398 23 Left 994715393 5:103315503-103315525 CCTTAGAAAATCCTCTATTTAAT No data
Right 994715398 5:103315549-103315571 CAGAAAGTAGAGAAGTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994715398 Original CRISPR CAGAAAGTAGAGAAGTAGTA AGG Intergenic
No off target data available for this crispr