ID: 994715902

View in Genome Browser
Species Human (GRCh38)
Location 5:103321201-103321223
Sequence ATGTAAACAAAAATGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994715902_994715909 -5 Left 994715902 5:103321201-103321223 CCCAGCCTCATTTTTGTTTACAT No data
Right 994715909 5:103321219-103321241 TACATGGGGGAGTCATTCTGTGG No data
994715902_994715910 4 Left 994715902 5:103321201-103321223 CCCAGCCTCATTTTTGTTTACAT No data
Right 994715910 5:103321228-103321250 GAGTCATTCTGTGGACTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994715902 Original CRISPR ATGTAAACAAAAATGAGGCT GGG (reversed) Intergenic
No off target data available for this crispr